TTHERM_00444560

Length: 1335 bp

cDNA Sequence

ATGGATATAGAAAGCAATAAAATATAGGATAATAGCTAAAGTAAAAATGATTACTTTAAAAGATAAAAAACCATTCCAGGATGGAATTAAGAAATTGTGTCCAATACAACTGCATTAGTTCTTGGAGCAGGTGGTTTAGGTAGTTGTGTTTCAATTCAATTAATGAGACTTGGCATTAAAAAACTTATTTTAGTTGATTATGATGTTGTTGACTATCATAATTTGAATCGCTAAATTATGTTTACTATAAATGACATTGGTAAATCAAAAGTTGAGAGTGCAAAGTAGAATTTATAGTTCCATAATATAAGTAATACAGAAATAGAAACACATAATATTAATGCTGTAACATAGTGGGAATAAATTGTAGCTTTAGCTAAGTAGTCAAATTTAGTTTTTAACTTAATAGATTATGGTGATTATTTTGATTTAGCAGTATGTAGTCTATGTATAAAACTTTCTCTCCCTATGTTTTAAGGAGGTACTTTTTGCAACTCGTTATCTGTTGATTATTTTACTTCTGATGGTAGACCATGCCTTCTTTGTTTAACTGATGGTTTAAAAAAGGAGTTTATTGAAAAATTAAATCCTTCTCTTATCCTCGAATACAAATCTTTGGAATTTTTACCCAAAAACGATAACCCTGAAGGATAATCAAACATAGTTATTTGTTAAATGTGTGCAAACTTTATTAACACATTTGTCTTGAATGAGCTATTTCCATCTGGGCAGAAAAAATCAAAGCGTATCCTCCTTTATTTAGATCCTATAGATATAATATCTTTTGATTTAGAAATAACTCCTAAATGCCCTTATTGCAGAGAGCCTTTTCATGAAGGAAATAGTTTCCATGAAGTGCAATCAGAAGAAATCCCATTAAGCAAAGAAGACCTATGGAAAGATATTAAAAATTTATAACTCTAAAAACTTTTCCCATAATATGTCTAGGAAATATAAGTAATTGAGGGTAGTTTAGGATAAATAGATAGTAAATTATAAATCACTTATAAAGATGGAGCTAAATGGACAGTTTAATTAGTTGAAATATCAAGCATAAAGTAAACTATTGTGTATGATGTTATTTAAACATAGCCTTAATTCAGCTGCAAAAAATTTAGAAATATATTTTAAATTTCTTAGCCAGATAATCAAAATGCATTAAATACTTGTGAATTATTATGGAGGACAGAATTTTAGGATGACATCACTATTAACGCTTATGAAGATACAAAATATAAAAAATATGATTACTTTAAAAATCTAATTGAAACAATTATCACAAATTCAAAAAATGAAGAAGATTAAAATAAGCAATAAAAATAATAATAAAGCTGA