TTHERM_00445920

Length: 1773 bp

cDNA Sequence

ATGGTTAAAAGTAGATTAGCTGCAATATTGCTCTTGTTTGCAGTCTAAAGCTTATTGGTATAAGCTGATTTACCTGTTCATTGCGTTAGATCTTAAATAACTGGTAAATGGTTACTTAAAGAAGGAAAAGTTCTAGCATCAAGTAATAACAAGCCTGTTTCTTGTGGTCATTAAATTCCTGATAAAGCAGAATCAAGCAATAGCGCCATGGGTGGTGTTTTAACTGAAGTTGAAAGAGAGTATGAAGTATTTTTAGATGAAGACTTCACAGTAAGAGGAAAAGAAGGTAAAGGTAGATGGACCTTAGTCTATGATGAAGGTTGGGAAATTGAATATAATGGAGTTAAATATACTCACTTTTTTAAGTATGCTAAAGACGACTCAGGATAATATAAATCTGTTTGCTCTCAAACCTTAGTTGGTTGGTTCAACCACATTCAAAAAAAATCTAGAGGATGCTCTTAAGCTATTAAAGCAGACGCATCTTAAGAATTCTCAGATAATGTATAGTAAGCTCATGTTGTATAACCCAAGGAAACTCAATACATTTTTTCTGAAATTTCATCTACAATGAATAAATTAAGCAGCTAATAAGAATAATAAAAAAGCTAAAAAATTAATGCTTCTAACTCTCTTAAAAGATAATAGCTTTCTTCCAAAAACAAGTTCCATCAATCAATTTACTTGAAGCCTCATGAAAATGTATTTGCTTAAATGAAACAAACACCTGCAACATTATTAAACCATTAAGAAATCGTTAAGAGATTAAACTCAATTAAAGGAAGTACATGGTAAGCTAAAGTTCCTTCTTTCATAAGCAAAATGAGTCTTGAGTAGATGAACACAAGAGCTGGTCTAAGAATGGATAAGCCTAAATTCAGTTACGACAACAAATAAGGCTCCTTTATTTAAAAATCATCATCTTCCTTGAGAGGTAACAAAGCAACTACCGATTATGCCCACTTTTCTATGGAGAACATATCAGATCTTCCTAAGTCTTTTGATTGGGCTGAATATATCCATGCTCCTCGTTCTTAAGAAGATTGTGGAAGTTGCTATGCTATTGCCACAACTTCTATGCTTTCATCTCGTTTGTGGATTAAATACGGTGATAATACTTAACTCTCACCCCAACACTCCTTGGCATGTAATTATTATAACTAAGGTTGCGATGGTGGTTATGGATTTTTGGTAAGCAAATTTTACAGTGAGTTCGAAGCTGTCCCTGAAAGTTGTCATCCTTATGAAGCTAGAGATGGTTAATGCAATCATTGCAATGTCGAATCTCTCAGTGAAGTATTCACAGTTACTGATTACGAATATATCGGTGGATCATATGGAAAATCAACTGAAAGATTGATGATGGAAGAAATATATAAAAACGGTCCTATTGTAGTCAGTTTTGAACCTAAAATGGATTTCATGTATTACAACAAGGGTATATATCACTCAGTTGATGCTAACCAATGGATTTAAAACAATGAAGAAAATCCTGTCTGGTAAAAAGTTGATCACTCAGTTCTCTGCTATGGTTGGGGAGAAGATGAAAACGGCAAATTCTGGTTATTACAAAACTCATGGGGTGAAGAATGGGGTGAGAATGGTAACTTCAGAATGAGAAGAGGAACTGATGAATCAAACATTGAAAGTATGGGTGAAAGAGCTAATATTGTAAAGACTGCAAGAAAATCTCCTAACACAACTGAATTTTCATCAACTTATTCATCTCACTCAGACAAATACTTTGTTGAAAAATCTAAAAGAAAATAATGA