TTHERM_00446400

Length: 4239 bp

cDNA Sequence

TTTCAGATTAAGAAGAATATCTATTAATAATTTAGATCAAAAAATTTATTATTTAGCGATATTTCAAATCAATTCTATTCTTATTTTTTAGAGAAAAAGTTAATTTTGATTAAAAGCTATAATAAGTATAATATAATTGTCTAGAGGAATCACATAAAAATGAATTAAGAATCAACTTCAAAAGTATAAGCATAAATGGAAGAAGAAATACCCACTGCTAAATCAGTTGTTAAACATACTTAAAGTCTGCTCAAAAATTCGGTTCTGAGATAAAATTTAGCTGGTAAGAGCGAGCAAAGACTTATTGTAAAGTAAATCGTGCTTGAAAACTTTAAGAGTTATTAAGGTAGATAAGTTATTGGTCCTTTCCATAAAAGATTTACTTCCGTTGTTGGGCCTAATGGTAGTGGTAAATCAAACTTGATTGAGTCTCTTCTTTTCGTATTTGGTAAAAAAGCTTCCTGGATGCGTCTCAAAAAACTTGAATAACTCATTCATAACTCTTCAAAGCATTAAAATGTTAAAAAAGCTTCTGTCGAAGTTACTTTCCATGAAATTAGAGATAAAGAAGGCGAAGAATATGAAGTTATTCCTGGAACTGAATTCACTGTTAGAAGAACAGTTAATAAATCTAGTGTTTCAAAATACGAGATCAACGATAAAGAAGTATCTCATGTAGAAGTTACTGATACTCTTAAATAGAAGGGTATTGATCTTACTAATAACCGTTTCTTAATTCTTTAAGGTGAAGTAGAGTAAATTTCACTTATGAAGCCTCGTTCTGGAGATCCAGAAAAACCTGGTTTGCTTGAATATTTGGAAGATATTATAGGTTCTAATTAATTCAAAGAAGATATTGAAAAGAAAGACGAAGAATATGAAGTCCTCTAGAATGAAAGAAGAGAAAAGGGAGAAAGAATGAGAATACACGAAGCTGATTTAGAAAAGCTATAAGAATCTAAGAATTTAGCCATCGAATACATTCGTAATGAAAAACTAAGCTATTAAATGACAAATATTATTGGATAGATCGATCTTTTAAGAAGTAAAAAAGATATAGAAAAGTTTGAAACAAAGATCAAATAAAATGAGCAATAAAATGTTGAAATGAGAGAAAAATTCAAATAGTAATTAAAGGAAAACGAACAAGTTATCAAAGAATATAAGCAAAGCAAAGCTGAAATAGAAAAAAAGGATTATGAAGTGTAAAAGTATAAAGGTCAATTAAAAAAATTGAATGAACGTGATGAATTAATTAGACAAAAGTTAGTATTAGAAACTGAAAACTAAACTAAAGCTGAGAAATAACTTGAAGATCTTCAAGATGAATATAAAAAAGCTATTCGTGATTAAAAAGAATATCAATCTGAATTGCCAGAAAAGTAAGATAGATTAAGAAAATTATTGACTAAAAAAGATGACGAAGATGAAAAGCTTAGAGAATTAAAAAGCAAAGTTAACAACGAAAACCAAAAGTTAGTTAAGGAAAAAAAAGAAATGGAAAAAAAATTATAACCAATTAAGGAGAAAAAACTTGAAGTTTAATCGAAGAGAGACACACTTTAAAACAGGTTTACTTTGATTTCTCAAGATGCCACAGCTATTTAAAATGAATATGAAAAGAATTAAAATGAATTAGAAAAAGCTAAATAATTAATAGAAGATTAGCATACATTGATTAAATAAATTGCTTAAGCTATTTAAGCCATTGAAGCAGGATATGAAAAATAAGAAGCTGATAATAAGGAATGTAGGATTATTGAAGAAAAAATTATTAAAGCCATTTCTGAATGCAAACAAAAAATTGATTAAACAAAATAATCTAATTAAGACTCTCAAACAAGAAATAAGGTTTTAAACGAATTAATGATAGCTTAACAATAAGGAAAGCTTAGAGGTATTTGTGGAAGATTGGGTGATTTAGCAGCTATCAATGAAGAATATGATGTTGCCATAACTACAGCATGTGGTCAATTAGACAATATTATTGTAGATAGATATGATGATGCTTAGAATGCAGTCAATTACTTGAGAAAGGAAAAAATTGGTAAAGCTTAATTTATTGCTTTAGATAAAATAGAACATAATAGATAATATATGGAAAAATAATTCTAATGTCCTAGAGGATCATAGAGATTATTTGATTTAATTTAATTCAAAGATTAGAAATATAAAGTTGCTTTTTACTTTGCTTTGAGAAATACTTTGGTTTGTGATAACATTGATCTTGCTACAGAAATAGCTTATGGTCAATAAAGACATAGAGTAGTCACTAAAAAAGGAGAATTAATTGATGATTCTGGTGTTATGTCTGGTGGTGGTGCTGCTAGAAGAGGTGGTATGGCCTCTCAATTAAAAGTGGAGATTTCTCCTGAGGAGGTTGAAAGATATCAAGCAGAATATAGCAGAAACTAATAAGACTTAGAATAAATTAGAGAAACAATTTAGAATACAAATAAGTAACTAAACACATTTATTTAGGAAAAGATGTACTTGGTAAAGTAGCTCGAAGCTAAGAAGTTTGATTAATAATTGTAGGAAGATAATGTAACCAGATGCCAAAATAGACTAAAAGCTCTTTAAAAGTAAATGGACGAATAAGAATAGAATGCAAAAGAAAGATAAGTCATCAAGTAGGAACTTGAAAAATTTGAAAGTGAATATCATGAATATGATGGATAAATCATGGAATTAAATAAAAAAATAACCGATATTGATGAGAAAATTAACAAATCAGGTGGCTAAGAACTTAAGCAATAACAAGAAATTTGCAAGAATATTTAAAATTAAACCTTAGAGTTGCAAGCAGACGTCAACAAAAAAACTGCTAAATTAAAAGACTTAGAAAAAACTTTAAAGAACAACGAAAGAGAAAAGAATGAGACATAGGAGAGAATCAAAAAAATAAAAGCTAGTATTGATCCATTAAAAGATTAGTAATAAAAACTTGAAGAAGATGCTGTTAAGGTATTCAAAGATTAACAATAAGCTGAATAGCAGTTAGCAATGTTACAAGAGTAGCAAAAGCAAAGAGATGAATAAAAGGCTGGAATTGAAAAAATTATTAAAGATATGAAGGATGCTTTAGAGAAATTAAAAAAAGAAAAAGATGACTTTGAAGCTAAAATTAACAAAGCAAAAGAAGATTAGAACAGAAGTGAACATGTTATTGCCAATAACAGAAATACTTACAAAGAAATTACTAAATCATATGATTTCTTACAATTCATTGATGAAATTGCTGGCTATTAAATTAATGAGAGTGAGGATAAGAAATCTGATGACCAAAATAATTTAGATAATATTTCTATCCTTGAAGAATCTATCATGCAATCTATGATGGATGAAGAGAAAAACACTTAAGATAAAGAGGATGATGAAGAAATTCCAGAAAATAATGATAAATAAAATAAAAAAATTAGATCAAGCAAAAACACTAAGAAAATAAGTAGTATTGATGTTTATGATGATATTGGTTAAGAATTGATTGAATAACTTGAAAATCACAGAGAATCATTAAAAATTGAAAAGGCTAAGGCTGAAGAAAAATTAAAGAGCATGACTAACGATGCCAACATCACTACTATTACTGAATTTAAAAATAAGTACATTGAATTTAAGTCCAAAAAGGAAGAATTTGAAAGAGTTAAAAATAGAATCTCAGAGCTTAAAGTAGATATTGATCGTCTTAAAAAAGAAAGATTTGAAAAATTCATGAGCGGCTTTAACCTTATCTCAGCTAAGCTAAAAGAAACATATTAAACATTAACAAATGGTGGTGATGCTGAACTTGAATTAATTGACTCTCTCGATCCTTTCTCAGATGGTGTTAATTTCACAGTAAGACCTCCTAAAAAATCTTGGAAATAAATCTCAAAGCTATCAGGTGGTGAAAAGACTTTAAGTTCTCTTTCTTTAGTTTTTGCTTTGCATTATTACAAGCCAACTCCATTATACTTTATGGATGAAATCGATGCTGCCTTAGATTTCAAGAATGTATCAATTGTTGGTAATTATATCCAAGAAAGAACTAAAAATGCACAATTCATTATTATTTCCTTAAGAAATAATATGTTTGAGCTTGCCAACAAATTAGTTGGAGTCTACAAAACATACGATACTACTAAAACTATTGCAATCATTCCTGAATTAATTTATTAAAAAATTCAACACTTGAATGATGATAAGACTGACACTAATTAAAACTAGAATGAAGATAAAGACAATAAGAGCAACTGA