TTHERM_00446520

Length: 450 bp

cDNA Sequence

ATGAAATTTAAAAATAATAAAAAATAAATCAAATAAATTTGCAATAAATAAATCAATTAATAATTTAGTAATTATTTAGTAAACATAAATGTTAACTTTCTTTTACAAATATAGCAAGATTTTACCAACCAATTAGATATTTAAGGAGGTCTTCCATGGACTAAGAAGAATGAAAATATTGAAAAACATCCAAGATTATATGGCTAAGAAGAAGCCAAAATGAAGACTTACTCTAATCTTTATGGTTCATAATTTCCTATGTTGTTGACTATTGAAAGAAACATCCTTGCTTAACCATCCAGACTTCCTGGTGAAAAATAATCATTATTAGGTCTTGATATTATGATGAATAGATTGAACTAAATTGAATTCGAAGATTTCTTGGGAACTGATAATCCTGAAATGCATAAACTTAATGCTCATGAACGTTTCTTAAAGAGCTTCGATTGA