TTHERM_00448570

Length: 2481 bp

cDNA Sequence

ATGAGCTAGATGAACTTTTCCTAAACAATCTAACTTAAGATTGAAACAGTAAAGACCTAATTCCTTAACTTCTTAAACAACTTTGAAGTAGTTGAAAATGGAAAAAAAATCAAGTATTACAGAGAAAAGGCACTTTTGTTGAAGATTTATGAAAAGAATACACTTTTTATTGACTTTAATCACTTATTAGATTTTATTGATGACAACGATATTTCAGATGTCATTTTAAACGACTACTACAAAATTGAACCTCACTTAAGAAAAATTGTTTCAAATTTCATCTTTAGTCTAACCAACACAAACGATAGCCAGGAAAGTTACTACCTTAGCTTTTACAACTTACCAACTGAAAAGAAAATTAGAGAATTGGGAACTTAAGAAATAGGTAAATTGAATAGTATTAAGGGTTTAGTTACTAGATCAAGTGAAGTACGTCCTGAATTACTTTATGGTACATTTATTTGCCAATTGTGTAATAGTGAAGTGCGTGATATTGAGTAGCAATTTAAATACACTGAACCTAAAATATGTTCAAACCCTGGCTGTAACAACCATACTAAGTGGATGTTAAAACCCTAATCATCAGTATTTTCTGATTTTTAGAAACTTAGAGTTCAAGAAGAATCTACTGACATTCCTGCAGGAGGTATGCCTCGTTCTATTGATATTGTTTGTAGAGGTGAAGTTGTTGACACCGCTAAGCCTGGTGATAAATGTATTTTCACTGGTTATTTAATTGTTGTTCCTGATATAGCAGCTCTTACTAAACCAGGTGAAAAAACTGAAATGGGTATTAAATCTGATGCCGTTAGAGTCAAAGGAGAAGGAAATAATGATGGTATTACTGGTCTCTCTCAACTAGGTCAAAGAGATTTGAACTACAGACTTGTTTTCTTAGCTATTAACATTGAAGCAAAAAAGAGTAGATTCAACTTATGGAATTAAGATGAAGAAGAAAATCAGGATTTAACTGAAGAAGAAGAAAGACAAAAAATTATGGAAAATTTCTCTGAAAGAGAACTTGAAGACATTTTTAAAATAAGCAGAAGTTCTAATGTTTATGAAAGATTAGCATCTAGTTTGTGTCCTACTGTACATGGTCACTTGGAAGTTAAAAAGGGTATTTTACTCATGCTTTTTGGTGGTGTCAACAAAAAAACAGAAGAAGGTATTAACTTGAGAGGTGATATCAACATTTGCATGGTAGGTGATCCATCTACTGCTAAGTCTCAATTCCTTAAATATGTTAATAAGCTTATTCCTCGTTCAGTCTATACTTCTGGTAAAGCATCAACATCTGCTGGTTTGACTGCAAGTGTTTCTAAAGATCCTGAAACTGGAGAAAATTGCATTGAAGCTGGTGCTTTGATGCTTTCTGACTAAGGTATTTGCTGTATCGATGAATTTGATAAGATGGATAAAAGAGATTAAGTCGCCATCCACGAAGCTATGGAACAATAAACAATTTCTATTTCAAAGGCAGGTATTCAAGCTACCTTGAATTCAAGAGCCAGTATTTTAGCTGCTGCAAACCCTGTTTTTGGTAGATACGATAAATCCAAGGGTTTAAAATACAACTTAGATATAAGCGCTCCCATTCTTTCTCGTTTCGATTTATTCTTTGTCATTTTGGATGAGTGCAACGAATAATCAGATAGAATGATTGCATAACATATTGTTAATATTCATTAAAGCTGTGGAAGAAATATCAATCCTGAAATCAGTACTGAAGATTTGTCTAAGTATATACGTTTTGCTAGAACTATAAAGCCAATTTTCACTCGTGAAGCTGCCCTCGAATTGCAAAAATGCTATGTAAAACTTAGATAAAATGATTCAAGCTCTTAAAATACTTCATACAGAATTACAGTCAGACAGCTTGAATCTCTTATTAGATTAAGTGAAGCTTTGGCTAGAGTTCACATTCAATCAGAAGTTACTGCTGAATTTGTATAGGAAGCCGCAAGATTACTCAGCAATTCTATTCTTAAAATAGAAAAGGGATAATTGGACATCTAAGATGAAGAAGAGCAAAAGATAGACCTCAACTAATAAAAAGAATAAGGCTAAAACATTATTTAAGAAGATATTGAAAAAAAACAACAATAATAAAGAAAGAAGGAAGGTAAAATCTCAATTACTTATGAGGAATACTTAAACATGAGAAAGATAATCATTCAAACAGTCAAAGATTTAGAAATAGAAGATAGTCTTAGAGTTTCCACAGAAGGAGAAGACGGAATGGAAGTTGAAAGACAAAATGGTTTCGAATAAAGAGTTATTATAGAATAAATTCTTAAGCAATTATTAGAAAATGACCTTATCCAAACAGAAGAAGATGCTACTAAATTAAAAAAAATATATTCTCAAATTATTAAAAAGTTAGTAGATGTAGACTAAGTTTTAATTGTTGTCGAAGAGGCCTCAAATTTAGACGAACGTAGATTATAACTTCATGCTAACTACTGCGAACCTAGTTGA