TTHERM_00448890

Length: 912 bp

cDNA Sequence

ATGAGTAAACCTGACAGAAGCTAGATACTTAGCTTACTTTATAATGTCATGGAATTTGAGAAGAAAAAGGATCCAAATTCTGAAAATAAATTACTGCATTAGGAGAGATTAATTTTGTTATGCACAGATTATTTGTCGGCTGGATTAGGATATGCAGATATTCCATTTAATTTTTCTGATTAATTCATTGATTATGCGTTATCTATCAATAAAATAGCTATGGATCATTTCAACTGCAATAATAACGAAAAGGCAATTCACTTTCTTTTGAAAGCTGTTGATATTTTGATGCATAAATCAATTCACAAATTTGTTAAGCCTGTTATAAAATATGGAGAAATGAAAGTTTTAACATTTAACAATTTAGCATGCATTTACTAAAAGCGCAAGCAATACGTTTTGGCTTTGAAAGCTGTTCACTTTGCTCTTGAATTAGAAGAAAGATTAGTTTAAGATAACGACTTTAATGCTAAAAACAGTATTATTTCTACTTTGTTTAATAAAGCTGCCATTTAAAGCAATTTAAACAAGCATAATAAAGCTCAAGATAGTTTAAATAAAGCCCTTCACTATATTGAAAGACTATAAAAAGAACTATAGCAAGGTAATTAATAGGATTAATAAGAAATATCTAAACAGTAAGAAAACGAAAAAGAATAAGAAGAAGAAGTTACTGGAAAAGCTAAAAATCCTTCTAACATCCAATTATCTGAAAAGGAAATAGAAGATAAATTATAAGAACTTAACAAACTTAAAATGATGTGCTTCTACAATTTAGGAGCAGAAGATGAACATCTCTATCATCAGGACAGGGCTCTATTATAATATTAAAAAGCTAAGTTAATTGCTGAAGAAATAAATGATTCAAATATGAGAGATCGTCTAAATAATATAATTAGCTAGCTTAAATGA