TTHERM_00455610

Length: 2772 bp

cDNA Sequence

ATGGAGAATAACCTTTTAGAATCAAGACTAAATAAAATCTTGTCAGATAAAAAGTTTAGCAAATTGAATAAAAGCATAGAGAAGCATCTCAATAAGGAAACAGGCATTTTTATTAAGGACTACTTTTTAGTTCTTGAATATGAATCACTTGATGAAAAGGTAATTCAGAGTAAAAAGAAGGAGCTTTTAGAAAATTCAATGCACGATCATATAGAAAAAGATGACGATTCTGTTTAATACTTTGCACTATACTTATGGATTTTTAATTTGACTGCAGGCCAATTCTTAGAAAATAACGAAAATAAATTAGCTACTAGAATACCTGTAAATTTACAAAGTTACAACATGTTCAATGCACAAGATTAATAAATATAGTCTGCCAAAAACACAATCGAAAGCTTTGGTAACGTCTTTTGCATGTCTAAGAAAATCGGAGAGTAATCTCTCTAAATAATAAATAGTAATATAGATGAATACTAAATAGCAATTTATTCTGAAAAATAAATTTTTGTTGGCCATATTGAAAACATTATAAATTCCTATTTTATTAAGCAAAGCAAAGATGATCAAAATGCCTTTACAATGTACCGTGTATAATTATTTATATAAAAATACTCTCCAAGCATTTTAAGCATTAAATTCCACAAATTATCTCCTCATCATTTGGCTGTTCTTTTAGATGATTAGTACTTTTGCGTTTATAATCTGCAATCTAGTCTTTCTTACTAGGAGGTGTAATTTAATCTTTAATAACTTCCACGCTTTGGTAGAAACGAAGAGTATAATTATTAAGAAAAAGGATAAGTTTAGTTTGTTGATTTCGAATTTGGAGGCAACAGCTTTTTCACTAGCTATTCGAAAACCAATTTCTAAATTCCTTCTGATTTCGATTTTCTGTCAGTATATTTTCTTACTGAAGATGGTTAAATTTACTACCAATCTCCATTTTTAGTAAAAGATATGAGAATTAACAGATAATTAATTGAAGAACTTAAGGATTATCTTGTTCAAGAATTAAAATTGGTGGAACAGCATGAATAAATATAAGAAAAATTATAGGTGTTAAAATCTTATTTAGACTTAGTAGAATAAATTGACAGCAGAGATTTGATAAGTGAATGCGAATAACCTACCAAATTATCTAAAATAGTTACTCAAACAGATAAGTCCAGTTCATTTGAAGTTCCTATTTTTAATAGCATCAGCATGCAAGACTTGCTGAATGATGATTTCTAAATACAATTAAGATATGTTCCTACAGAATAAAATAACGAAGATGATTAAGAAAATTTAGAAAATAACAGTAACTTACAGTCTCAGTTTAAATCAAGTGGCTTTGGAACAAAATCTAACATCTAAGTTTTTTCAAAATCGTTAATGGACAGATTTACTAGAGATAATAAGAATCAAATTATGTATAGGAAATATAGTAAATTCCACAAAGTGGAAACAAAGGGTTAACTCCATGTCTTTATTTTAACAAAGCAAATCGGTAATAAAACTTACTCTACTGTATCTTCACGTTTTAGTCCTCTTCCAGTCATGCCTACTCATATTGTTCAAGACTTTTACTAGTTTTGTCTTTTATCTGGTGAAAAAGCACATCTTGAATGCCCATTAAGCTCTTTAATCAACTATACAGGAAATTAATCTAAAAAGAATATCTATGAATATAAATAAAATTAATGTGCTAGACTCTGTTCTAAGGCAATTGAAACATCAACACTTGACAGTGTTTGCTTCTAACTTATGAATAGAATATATTGTATTAACTTTAAGTGGATTTAGAATTTGATTTTAACAAACTTATCAGACCCTAAAGTATTTAATGATGAAGAATTGTCTAGAAGTGAAATTAGAGTCTTAGTTGATTCTCAGCAAATCGATAGCTAGGATAAATTAGATGCATGTAAATTAACAGATTTATCTTTTTATTGCTTATCTGAAAAAGACAGAATGCTTCTAGCAGTTATTCCTTCCCACCACTCACAATAGTAATAGCCTTTTAGGTTAAAATGCTTAACTTTAGACTTCTTGTCAAACTATATTTAAATTTAAAAGAGTGCTAAGCTTATATCTGAGACTTTACACAAGATGATTAAAGAATAAGTAGAGCCTGAAAAAGCAAAAGAAAATAACCAATCAGGATAAAAACTAGCTTAAAATGATGTGAAGCTTCAGGAAATTGCTGATTAAGATAATAAAGTAGATCTTGATAACTTTTAAAAGTAAGTAACAGCTTACATAAGCAAGCATGAAGAAGTTTTATAATAGAATATTTAGTTAATACAAATTAAATATCAAGAGGTATTAAAGAAAAAAGAAGAGTTGAAAAATACAAAGGAAAAAACAGAAAGCCAATTTTATGAAATCATAGAAAACAAATAAAAGAAGTTGTTAGAAAGCAAAAAAAGAATTGAAGAAAAAAATAAGTCAATCAATTAAAAAATTTAAGAAATTGCTTAAAAATTAAAAGACCCTAAAGCTTCAAATGAATTAGACAATGTTAAAGAAGCAAATATCACATTTAATGAAAAATATAATGAGTAAATTAAGACATACTATAATAAACTTAAAGAAATCGAAGAATAATACTAAAAGTACTTCAAAACTAGAAGTGAGTTCTTCAATTCATTAGGTGTTCAAAGCAATACAAACCTACAAATTGATGAAAACACTTTATAAAAAATTAATGAAACAAGAAATAAGCTAAAATACCACATGAAAATCCTTGATAATTAGATCATTTAAACCAATCCTCAAGATAATTGA