TTHERM_00459380

Length: 2040 bp

cDNA Sequence

ATGGGAAGAAGAGATTATAAAAACAGATCTTCTTCGCGATCACCATCCAATTAAGAGGTAGATGAGTAAAAAGATAAAAAGAGAAGATAAGATAGAGATAGATCGAGAAGAAGATCATCATCTTCATCTTCTAATTCTCAAAGAAGAAAGGGAGATAAATAAAAGTAAAATAAGTAGCAATCAAGATCCAGATCAAAGGAAAATAAAAGTAGAAATGATAAAAAGAACAAAAAGAAATAAAATAAGAATTAATCAAGGTCTTCTTCTTCTTAATCTTCTTCTTCTTCATCATCTTCCTCATCAGGTAGCGACGAAGAGGCTGAAAAGAAATAAGCTGAAGAATATCTTAAAATGACTAAAATGAGATAGGAAATAATAGAAAGAGAATTACAATATAAAGGAGAGGAGAATCCTTTTGGTGACAAAGATATTGCAGAAACATTAAATTGGGGTAAAAATGCCAATAATTAAAATAAATCTATTCATGAAATTATGGATGATATATAACGTGTTAAATAAATACGTTAGTAGCGTAAGGAAGATGAAAAGCGTTTAGAAGAAATGAGAAATAAGGCAATACAGGAAAGAGAGGAAGAGTAATATTAGTAATGGAAAGAAAAAGAGGAAAAGTTTCATGCATACTAGGCTCGTATAAGAGCCCTTGTGCGTATTACTCAAGGAAAAGAGACAACAGTAGATAAAATTAACAAAATTTTTTATATCTATCGTCGAAAGATTAAATACAGTGAGCATTTAGATCCAATTATGAGCAATGTATAAGCCTTTATAAAGAAATAAGATGAAGAAGAACTCGAAAAAATATTAGCTCAGGCAATTAATCATCACAATTAATTACAAGACCCCGTAGCTATCAATGACTAATAGTATAAAGATGAAAGCGAAATAGTTAAATTTTCTTAGTTTTGGGAAAGTATAAGGTCTATCACTTAATATTATTTGGATGAATTTCGTAAGAGAGATTAGTAAAAGGAAGTGTTACCTGAGTTTGAAGAGGAAATAAAAGCTATTTTTGAAGGTAAAAATCTGGAAGAACTTCTTGAGCTAGAAAAAGGAATCAACCAAAGTATATAACTCACAAAGTATGGAAGCTAAGAAGATCAATAATATTGGCAAAATATGCATAAAAGATTACAATTATATAAAGGAGATGCCATTCTAAAGAATTTTTATGATTATTTTTCTACTCATTAGAATGAGTTTCAAGCAGAAGATGCTCTTGAAATAGAAGTGGAAAATAAACCACAGCTTACTGAGGAATAATTATTAGCTGAGTAAATATAAACCGAGTAGTTAGAAGCTGAAGCTCATGTTTACTCTCCTATACTAATGCCTATCAGTGAAGAAACACTACGTTCTTCATAAACCTAATCAGAATTTACAGAGTAGGTTGTTTAACTTAGATAAGTCTATTATAACAAAATATTAAAACGAGCTTTAACAGCTTTAGAAAATAAGCGCGAAAAAGAATCTAAGCTAATAGATACATTTGTTCCCGTAATTGGTGGTTTAACAACTGTGAAACAAGATAGAGAAGATGTAGATGCTGCCACACTACATTTACTGGAAATGGAAAAGAAAAAACCAATGGAAGATGGAGAATAAGTATTTGATGATCAGCAAGCTATTGAAGATAAAGACTATAATTGGTCTGACAAATACAAATCAAAGAAGCCTAAGTATTATAATCGTGTTAAATTAGGATTCGATTGGAATAAATATAATAGAGCTCATTATGATTCTGATAATCCTCCTCCAAAGTACGTACAAGGTTATAAATTTAATATTTTCTACCCAGAGCTGGTTGATATGTAAAAGACTCCAGAATATTTCTTAGAGCCTACAGATGAACAAGGATATTGTATTATCAGATTTACTGCTGGGCCACCTTATGAAGATGTAGCTTTTAAAATCATCAATAAAGAATGGGATTATGCAGACAAAAAAGGATTTAAATGTTATTTCAATCGTGGTGTTTTAACTTTGCACTTTAATTTTAAAAGAAGTATTTCAAGACGTTGA