TTHERM_00462850

Length: 744 bp

cDNA Sequence

ATGGCAGATAAATTTTAGCCCTTTTAAGAAGAAACTGATCATGGAGATTAAAATTTAGATTTTAACATCTCTATGGATGATAATTCTTAATAAGCAAAAAAATCCATTGATAGCGATGCAAAAATCCAATAATAGCAATAGCTTCAAAAATAAAAGCAAACTATTACAATCCCTGCTGAATCTCTTCCTGATTATTCAAAAACTGTAAGAGTAGGTGAAACATCTTATCTTAGTTAAGCATCTCATCCTAAAATGTGCATATTATAATTATTATTCAAAGCATCTTCGATTACAACCTTACTATTAACTTCCTTTGTTTTTGATTTCTTTGATACTAATAAAACATTCCCATTTGTTATTATTGTTCTCTCAGCTGCCTTTGACTTCTGGGTTGTCAAAAATCTTACTGGCAGATTCCTCGTTAAGTTGAGATGGTGGAGTGAAATTAATGAAGATGGTACTGAATAATGGAGATTCGAAAGTTACGAAGATGGAGTACCTCCTAATGCAATTGATTCTGGTTTCTTTTGGTTTTCATAAACTGGTGCTTTAGTTTTCTGGATTCTATGCTGCATTATTAATCTGTTAGCCATCAGTCCATTTTATTTCACACTTAGCATGATAAATACAATATTAGTAGGAGGTAATTTCACAGGTTACTATAAATGCAAAGGAGCTCACCAAAAGAAAATGAAAAATGCTGTTTCTAAATTAGGTTTAAAGATTATTAGTGATGCTTTTTGA