TTHERM_00463160

Length: 5469 bp

cDNA Sequence

ATGGCTACAAAAAAAGTAGAAAATGAATCCGCTCAATATTCTTGGATTGTTCCACAGGAATATTGCTGGATTGCAGAATAAAACTTGAATGATTAAAATTCAGAGGTATTTGTACCTGCTTAGATTTTAGGTTTTAACAAAATTACAAGAATGGCTACTTGTTAGTTAAGCAGTGGTGGCGATCCTAAGGAAATTCAAGCAGATAGATTGCTAATCAGGAATGAATAAAATGAGACATTTGATGACATGGTTAATATGGATTTGTTAAATGAAGCAGAGCTTCTCTAAAATTTAAGAAAAAGATATGATGAAAATAAAATTTATACATATGTTGGACCAACATTGTTGGCTGTAAACCCTTTCAAAAAGATAGATAATCTATATGAAGAGTAAACTCTCCTGAAATATATATCGATTATTGAAAACTTTTCAGAAAAGAATCTTCATAAGAAAATTCCTCCTCATGTTTATGGTCTCACAGCTGAGTCTTTTAAGGATTTATTTTTAAATGAAAAGAACCAAGCTCTAGTTATTTCGGGTGAATCTGGCGCTGGAAAAACTGAAAACACAAAATATTGTATGAAATTTTTAACATCTCTTGGTAATTTAGAATTAACTAGCTAAGAAAAGCTTACAGGAGTTAAAGACCTCGAAGTTAAAAGAAGAAAATCATCTTATTAAGCTAAAATTCATAATAGGCCTTCAATAGAAGACAAAATTTTGAGCTGCAATCCAATTTTAGAAGCTTTTGGTAATGCTAAAACAGTGAGAAATGATAACTCGAGTAGATTTGGTAAATATGTAACAATTATAGTGAATAAACATAATAAAATGATTGAAGGAGCTTAAATTGTTAACTATCTCCTAGAAAAAGCTCGTATAACCAACTAGGGATAGGGAGAGAGAAGCTTCCACATATTTTATCACTTTTTAAAGGGTGCTGATAAAGAGTGTTTGCAGAGATATGGACTTGAGTATCCTGTTTCTTTTGAAAAGTATGCATATTTATCATAGTCAAAGTGCTACGCTGTTGATAAAATAGACGACATCAAACTGTTTTAAGAAGTCAATCAATCATTTTAGATTTTAGGATTTGAAAATGTTTAAGATTCTATTTATTGCTTTATTTCAGCTATCCTTTTACTAGGAAACTTACAATTTAATGACAAAACCTTATCTAACGAAGTTCTAAGCTAAATTGCTAAGCTTCTTCAAATTGATGAAAAGTAGCTTATAGAAGGCTTTACTTTTAGGTTAAGAGTGATTCAAAAATAAAATTTTATGAGTCCTTTGTAAAAAATAGAATGCATTAATACTAAAGATAGCTTGTCTAAGTATTTATATGAAAGAATGTTCAATTTAATTGTGTAAAAGCTTAACGAAATAATAGTGCCAAAAGAAAGCATAGACGAGTCTAAAATAAGTAAAATAGGGCTTCTAGACATATACGGCTTTGAAGTATTCAAAGAAAATGGTTTTGAATAGTTTTTTATTAACTACACTAACGAAAAATTGCAACAACTCTATATTTAATATGTATTTAAGTAAGAAGAGCAAGTCTTTGTAAAAGAAGGACTTGAAAGCTACCTCCAATATTTAAGTTTTACAGATAATAAACCTGTTATTGATTTATTAGACATGCCACCTAGCGGTATATTTAATATATTAGATGATATTTGCTAGACAAAAGGTAATGATGAAAAGTTTTTGAACAAAATCCGCTAAACACATAAAAACAACAAATATTTTCAGATTCCCAGAATCACTGCAAAGCCAACTTTTACTATTGTTCATTCTGCTAAGGAAGTAGAATATACTGCCACAGTTTTTACTGAGAAAAATTAAGATGAAATTTAAGAGCTGATAATGAATGCTTTATTATAGTCTAAAAATGAACTACTCTCCTCATTAGCTTAGCAGGAAATTGAATCAAACAAGAACAAAAAAAAGGAAAAATCTTTGGGAAGTAAATTTAGAACGGAAATGTAATATTTAATGAATGACTTAATGGCTTGTGACTGTCATTTCATAAGATGCATAAAGCCCAATGAAGAAAAGAAAGCAAATTGTTTTAGACCCGTTAATGCCCTTTAGCAAGTAAGATATTTAGGTGTCTTAGAATCTATTAAAGTTAGAAAGTAATCATATCCAATAAGAAAAAATTACTAGCTTTTCTACAAAAGATACTCACTTATAAACTAAGATTTTAAGCCTTATCAGCAACTGTGTTAAGAAGACGCTGACTTTATTTCTCTAAGCAAAGGACAAATAAATATAAATTTTAAAAGCTTGTTCAAGACAGTGTTCAAAGGTATAGATGGCAATGGAAATATATTATTTGGAAAATCAAGAATTTTCATGTAAAACAGAGCTCTAAATGACATAGAATAAGTGTATGAAAACAAATTAGAACAGCTAAACAAAACTGCAAAGAGATTCTAAAAAGCTTATTACTCGATATGCTAACAGCTGATAAAGGTGAAGATCTTATACAAGAAATTTAAGGATTAAAGAAAAAAAGCATAGAAGATATAAAATTGGTATCGAAGACATTTGCAGAGAGAGCTCATTAGAAAATATAGACAGTCTGCTTTAGTCATATAAAACTATATTAATTATGCAATAAAACTTGAATATTTTAGCATTGTCAAGAAAAATGTTCTTGTGATACAAAAATGTATTAGAAAATTTTTGGAAAAAGCTAGGTTAAGAAATATTTAGCATTGCAAGGATAAAATAGAGGTCTTGCATTTAGATTTAAAAAATTATTCGCGGTTTTTTGGCAAGGCAGAAGCTCAGGGAAATGATTTTAAGAGTAAAGATGGTTGGAAGAATGATAAGGGAAAGAAAGGCTGCTACTAAAATTCAAACTAATTACAGAATGCATACTAATAGAAAGAAATTTTTAGAAAAAAAGAAAGCTGCTATGAAGATTTAGGCTTTTATAAAGATGAAAATCTTGTCTGCGTTTTACAAATAATTAAAATTCTCCACAAATAAAATACAAAACATATCAGATTAGAAAGATTGTAGTCTTATGTTAATTAATGTGACTTTAAAAATTTACTTTCTACTGAATAGTCTAACTCACTTGGATAAGCTGAAGAAAATAATTTATACTCTAATGTTTAAGAGATGTATTACATATAAAAAAAGATCTAATATAAAAGAAAAAATGCTGGTAAAAAAATGACTTTGAATAACAAAAAGGTATCTGAAACGATTATTCCTGGAATTTAAATACAAAAGAAAACATCTATCAAACCACTTTTTAGCTCTCAAAAGAGTTAAGAATAAATTTCAAAAATGGTAAACAAATAAGTATGTGAGAATTCTTAATAAAAACCAACATCAGAAGGGAATAAAAATAAGATTAAGCTTAAATAAATATCATAATAGTAATTTAATAATTAGACTGATGAAAATAAACTACAAAATTCTCATGAAAGAGATCATTCTTAAGATATCGTCAATAGCAACAGCTGTATTGATTTACAAGATATTTTAGATAGGCATCAAGCATAAAAAACAAATATAATAAGCCCATTAAAAATAGAAGACCAAAAAGCTATCACGAACTAATCAAATGTTGCTAAAAGGTAAAAGCTGAGATAAAAAGAAAATGAATCAGATTAAAATAAATAATTTAGAAAGAGCATATTAAACTCAATGGAGAATCCCTCCAATAATAAATTAGATAATTCTAACTAAAATACCTAAGAATAAAAAATTCAAGACATGTACTATTATACTTCTGATCTTGCTAAAATGCATAACCAAACATCCCCTTAAAAAATAAACTGCACCTAATAAGTCCTTCCTAAAAATCTTACAAATATTCAATCGCCGCTAAATAAAACTTCAAGAGCTAATGAAAGCAATTAAAATATCAAAAAAACATAACTGATAGATTCTTAGTATAAATTAACATTGGTACCTTAGAAAGTTTACATGATTTCTCATCTGATAGATTTTGAAATTTTATCTGATACGAAAGATATTTATCCACCTAATGGCTGGTCAGAGTACTTCTAATAGCAATTCCAACAAAGCTATTTGAAAAAAGATTACTTGTAAGCCATTTACATTGGAGAAACACACACTGTTGCAGTTAGCAATAACAATTAACTTTACACATGGGGATGGAATGATTTTGGGTAGCTTGGAACTCCAGAGGAGATATCAGAAAATGAACTTAAAGCAAGTGTTGGTAATGATTTTACTTTAATTTTATCAAAAGAAGGAAAGCTATTTGGATGGGGAAAAAATAATAAAGGATAGCTTGGATTTTATGATGATGAAGGACTAATAAAAAATGTGGATATTCCTATGGAAATAATCTCAGTTAAAGAAGATAAAATAAAAGGCATCAAATGTAGAATGAATTCAGCCTACATTATCTTAAATAATGGCTCTGTTTATACAAATTAAAAGTATAGTCCTTACTAGAAAATTAACTTCTCTTAGAAAGTAGAAAGAGTTTCATGTGGATTTAATTTTACAGTATTTTTAACCACTAGCCATTAAATATACTCTTATGGAAAAAATTAGCATGGGTAGCTAGGTTTGGGTGACTTCGTACAAAGAAAAGAACCAACTTTGATTCCCTTCTTCAAAACAAACTAAATTAACTAGGTGGAGTGTGGATTTGCTCATGTTGTTTGCTAGACAAACTATGGAAGAGTATACGTGTGGGGATGGGGATAATGCGGTTAACTAGGTCTTGGAGATTATCAAGATTAGCAAGAACCTTAGTTGTGTAACTTAAATAATCTTTATAAAGATATAGTTATTTAAGTTTGTGCTACTAGAACAAGTACCTTGCTTTTACTTAATAACTCAGATATCCTTTGGTTTGGCACTAATCAAAGCATTAAATACTAAGAAAATCCAACGATTTACAAAGTATCGGAAAAGCTAAAACAACTAGAAGGAACTTTTTGCATGAGATTAACAAGCTCATGGAGTAAAACACTTGGTGTTGTCTATGGTACTTTTGCTTTTAGCAAAGATTTAAGTGATAGTGTTCTTTAGTCCACATGCAATACCCTAACAAAAAAATGGGTTAAATAGAATATTGATTAAATTAAACCACCTACAATTTAGAGCATTATTCACAAATTACCTCAATAATATATTGATTTGAAAGAAAGCCCAAAAAAAGCTAAGAATATTTCTGACCTTGTACAAAAAACTTAATCTCCTTAAATAGTAAAAGTAGAGGATTTTTCTAATATCAGCAATATATAAGAAGCTAGCTTTGTTTAATTCGATGTTGAAAAGAGTTTGAATGAATTTTAACAAAGAGAGGATGAAGAGAGAAAAAAACTTAAAGAACTTAAAAATAAAATAGAGTTCTTGAAGACCCTTCCATAAAAATAATTAAGGTAAATAGATAAACAACTCATTTAGCTCTACGAACAAAAGCAATACAGCTAAATTCTATCAAATAAAAAATTCTTTAATTGA