TTHERM_00463890

Length: 459 bp

cDNA Sequence

ATGAACAAATTTATTATCGTTCTCGCTGCTATTTTAGCTATTTCTTCTGCCTAAACTTTCCTCTGTGAAGAAAAGGATAGATCTGCCAACAAATTATGCACTGACATTTATGAACCTGTTTGTGCAATCAAGCAATCCAACTTACAAGGTGGCAAACCCCTTAGAACTACTTTCTCTAGTCACTGCAATGCTTGCAAAGACTCAAGTGTCCTTTTCGTTGCTGAGGGTCCTTGTGAAGCCTATCCTGAAAACGGTACTTTCTGCCATCCCAACTCTGTCAACAACAAAATGTGCCCCATGATTTACTCCCCTGTTTGTGGTATCGTCCATAATCTCTTTATGTTATGCCAAGGTGGTCCTTGTGTTCAAACTTTCGGCAATGGTTGCTAAGCTTGCACAGGTGGTTCATTCTTCTACACTCCTGGTAAATGTCTTAGCAAATTCGATTAAGATTAATGA