TTHERM_00467500

Length: 1203 bp

cDNA Sequence

ATGAACGGTTTATCTTCAAATTCTGGTCCTAGAGAAGTCATTTGTGCTCTCTTGAGAAACTTTTATACTTAAGGATGGTGCGCTGGTTCAGGTGGTGGTATATCTATTAGAAAAAGCGACGATGAAATATATGTTGCACCTTCAGGTGTATAAAAAGAATTGGTTTAACCTGAAGATATCTATGTTATTAATGTTAATGGAGATGTAGTTGAAAACCCTAAAAATCCAAAATTAAAACCTTCTGAATGCACTCCTCTTTTTAATGCAGCTTATAAGCTTCGTCGTGCTGGTGCTGTTTTACATTCTCATGCTCTTCCTGCAATGCTAGTTACCAAGCTCTTTGGAACTGAATTTTAGACAATTGATCATGAAATGATTAAAGGTATTCCTAATCACCATAATACAGAATGGTGTGTCGTCCCTATCATTGAAAACACTGAAAAGGAATGCGAATTAACAGAACGTTTAACTAATGCAATCAACGCTTATCCTCGTTCTAATGCTGTCTTAGTTCGTAATCACGGTGTTTATATTTGGGGAGAAAATTGGGAAAAAGCAAAAATACATGCTGAGTGTTACCATTATTTATTCGAAGCAGTTGTTGAAATGAAGAAATTAGGTTTAGAAATTCCACGCACTGTTTCAAGCAGTAGCCAATTACGTGCTTGGTATATTGATGAAAATGCAATTGGCCAAGATGGTGATATTCGTGAGAGCTTACACTATCGCTCATATAAGTGGGTTAATCCAGAATATTTGGCAACAATTGGTGTTGAACACTGGAAATTAGACGGAGAAGAGAATAATACTGAACTTGAAAGAGTTTGCAAATAAAGAAATTACTCTTCTCGTGATTAAATTAAATGTGGAAATCATTGTGAAAATTACTAACAAATGTTATCAAATTTCAGAAAAGAACACATCCATTTAGATGAAGAGATTCGCTATATTATAGGTGGTAGTGGTTATTTTGATGTCCGTGACCATGAAGATAAATGGATTCGTATCCAAAGTGTTAAAGGTGATTTAATTGTACTTCCTGAAGGTATATATCACCGCTTTACAACTGATAAAAATGATGGAGTTCATGCTATGAGATTATTTAAGGATGAACCTAAATGGACACCTTATAATCGTCCTTGTGATGAATTGGAAAGCCGTAACAAATATGTAGATTAATTCTTAAAAAAGTTTTAAAAATGA