TTHERM_00467770

Length: 861 bp

cDNA Sequence

ATGAATTTTTATGATTATGATAGCAATACACCAGAATATAAATTCTACGAAGATTTATATCTCGAAGTTTCTGTTTCAAATAAAGCCAAGTGCAGATCTTGTGGCAAAACTATTGATAAAGATGTGCTCAGATGGTGTAGCTCAGAAAGAGATAGAGCTGAACCTATTTATGTAAGTAAAAGATATTATCACCAAAAGTGTTTACCTCCTGTAGCTGGTCATCCTATCGTTGATTATAACCCTAAAACATAAACAGGAAAGCTTAAAAACATGAATGTAAATCCATCTAAGTAAACAGAAAAGGATTTATTTAACAATGCTGTGGATGAATATGTTAAATACAGAAACAACTATGATAAAAAAAGTAAAAAATAAGATAAAAACTGGGATCCAGATAACTCAGATTCTGATTCAGGAGAAGAGGTAGTTAAAAAAGCAAAGAAAGCTACAAAAGTGAATAAGTCTGAAAAGAAAACCAACAAGAGATCAAAAGCTGATGATAGCGATGAAGATATAGATGCTGAAGTTAGCTTGGCTGGATACACAGATGGTTAAAGATAAAAATACTTAAAAAAATTAGAAGAACTAAAATCTAAAACTGTTGCTTAACTCAAAGCTATTTTAAAAGCAAATAATTAAACATAAACAGGTACTAAAGAAGTACTTTTAGAAAAAGTAGCAGATGGATACACCCTTGGTGCTATACCACAATGCACTAAATGTGGAGGGGGTAAACTAAGATTCAACAAATCTACAGGAGAGTATACTTGTCCTGGATTTATGGAAGATACTGATAAAGTTGATTGTGATGCTGTATTCTCAATAGATTAAGTTGTTAGATTTGATTGGGTAGAACCATGA