TTHERM_00469100

Length: 1173 bp

cDNA Sequence

ATGGCTTCAACTGATAATCCAGTAGTTTAAAATTACCTTAGAGTTAAGCGTGAACATGAGAAGATGGAAATCGATTTAAAAAAGCAAAGATTCAACTTACGTGACTTGAATAAGCAATTAGATAAAACTGATGATTAGCTTAAGGCTATCTAAAGTGTAGGATAACCAATTGGTGAAGTTTTAAAGCAAATTAATGAAGAAAAATACATTGTTAAATCATCAAGTGGCCCTAGATACGTAGTTGGTGTTAAATCTAAAATTAATAGAGAAAAGCTTGTTATTGGAGCTAGAGTAGCATTAGATTAGAATACTTATACTATTGTTAGAATCTTGCCTAGAGAAGTAGATCCTATGGTATATCATATGTTACATGAAGATCCAGGTAAAGTTACCTTTGACGATGTCGGTGGTTTAGATGACTAAATTAGAACTCTTAGAGAAACTATTGAGTTACCAATCACAAATCCAGAATTGTTTAGAAGAGTAGGTGTTAAGCCTCCTAAAGGTTGTTTGATGTATGGACCTCCTGGTACTGGTAAAACTTTAATTGCAAGAGCTCTTGCCAATAATGTTGATGCAAAATTCTTAAAGGTTGTAGCATCAGGTATAGTAGATAAATATATTGGTGAATCTGCAAGAGTTATTCGTGAAATGTTCGCTTTTGCAAGAGAGCACGAACCATGCATTATATTTATGGATGAAATCGATGCTATTGGTGGTCGTAGATTTTCAGAAGGTTCTTCTGCTGATAGAGAAATCCAAAGAACTTTGATGGAACTTCTAAATCAAATTGATGGTTTTGATGATTTAAAGAGAGTCAAGATTGTTATGGCCACAAATAGACCCGATGTGCTTGATCCTGCACTTATGAGACCAGGTCGTTTAGATAGAAAAGTAGAAATTCCCTTACCTAATGAATAGGCCCGTGCAAAAATTTTAGGCATTCATATGAAAACTATTACTATATTAGGTGAAGTAACTTATATTGAAGAACTTGCCAAGCTTACAGAAGATTTCAATGGAGCTGATTTACGTAACGTATGTACAGAAGCAGGTATGTTTGCTATTAGAGCTGGTAGAGATTATGTCATTTAAGAAGATTTCTTCAAGGCTGCTAGAAAGATAAAAGAATCTAAAAAATTAGAATCTAAGTTAGATTACAGCAAAGTTTGA