TTHERM_00474670

Length: 900 bp

cDNA Sequence

ATGAACGATCTTTACAACTTTTTAGCTGGAGGTATCTCAGGAGTAGCTTCAAGAACAGCTGTAGCTCCTATTGAAAGAGTGATCATCCTTAAGCAAACTTCTATTGAGTAGTATTAAGGAAGTAATACAATTTAAGCTATTCTAAAAATGTATAAAATTGAAGGTGTAAGATCTCTCTTCAAAGGCAATTATGTCAATTGTTTAAGAATATTCCCTTTTTAAGCTATTGAATTCTTCATGTTTGATAAATACAAAAAATCATACAATCAATATATGTCAAGCTATATACAGCTAAACAGAGTAGCTCTTGATCTAATAGCTGGAGCATTAGCTGGAGTTACAGCTTCTGCCTGCATTTATCCTTTAGACTTAGCTAAGACTCATCTAGCTGTTAACATCTCAAAAACACCAAACGCATCTAACCCAGGATGTATATAAATTTGGAAAGAAATTATTCTTCATGAAGGTTTCAGAGGACTTTTTAAAGGACTCTCTGCTACAATGATTGGCATGGCTCCTTATGCTAGCTTAAAGCTAACTTTCTTCAATAACTTATAGTATTACGCAAGTAAATAGTTAAATAAAGATTAAAAATAAATGCCCCTTTATTGGAACCTTGCTATTGGCGGTCTTTCAGGATGTCTAGCTGTTACTATAACCTATCCCACTGACCTGATTCGTAGAAATTTGCAAATAGCAAAAATGAATTCTAATACTAAACCAACTTATCTTAGTATAATAAAAAAAATTTACAACAAAAGTGGTTTAATTGGCCTATACAGAGGGTTACCTGCAACTTACTGCAAAATTTTACCTTCTACAGCTATAGTTTTTGCAATCAATGACTGTTTGAAATAAATTAGAACAAAATTCCAAACAGGTAAACTCTTACAATATTGA