TTHERM_00481330

Length: 624 bp

cDNA Sequence

ATGGCTTTAAGAAGAGTATTAAAGAATCAATTCAATTTAATTCATAAGGGATAGGCTCAAGCTGTCAGAGGTGGACATGGTTGGGATAGACCTGATGTTCCCCTTAGCTTCAACCCTCTTTATGTTCATAAGCGTGAACTTTCTATCTTCGATACTAATATGTGGATGTACGATTAAGTCTATCCTGAATACGTAATTTCCTATAATGAAATTCATTTAGTTGATTAATGGAAAGGTCTCAAGGAGTCATTTTCTTAATCTGCCTACTGGTGGGCTATGATGGCTATGGTTTTTGGATTCTACTTCATTAACACTACTCCTAGATAACTTGGTATTGATACTAATGACTTAAAGGGTTTCCTTGGTGAATACTATGGTCAATACAAAAAGAGAAGTGGTATTAGATCCAATTTCCTTGGTTTAGATGTCACTGGTGAAAACTCCATCATCCAGCCCAATTATGACAGAAAGAATGGTATCAGAGATGTTATTGACTCTCTTAATGCTGATGCTGGAAAAAGAAAACTCATCAATTTAGAAGCTAAGAACTTTATTGAAAGAGTTGAAAAGGAATGTGAATAACGTATACTCAAGAAAGGTGGTGCTACTTAATCTCACCACTGA