TTHERM_00481340

Length: 1113 bp

cDNA Sequence

ATGAAACAAAGAGAATTCACCAGTTCAGTGCTAGAAAATTAGAATCGTTTATTTTAGAGCTAATCAGAAGAAAAAAAAGTAGAAGAAAATAATTTAAAATTACTTAATGATTGCGTCAAAAAGGGTTTAAATAATAATTAATAAATATAAAAATAAATAAATTAGCAAACTAAAATGTCAACAAAAGAATTCAGCCTTAGCTATGAATACTAAGAAGGAAAGTGGTAAGAAACTAAAGAGTCTTCTTGTTTTTCCTCACAAAGTTGCAACAAAAATCTTAAGATAGGAGCTTTTAATGTTTTATGGGGAAATTCTAATAAGTTTATCAACATGTTTAACAGAAACGAGCAAAGATTTAACTATATAATCAATAAGCTGATTCCTCAGACTGATCCAGATATACTCTCGCTATTAGAAGTTTCAGAATAATTTATGGAAATGCTTACTTCAAACTAGCATATTAGAAATAATTATTACTTGAGTCATGTTAAAAGAAAAAGAATTGACTATGTTCACGAAGTGGTAATGATATCCAAGCTTCCTTTTTCTTCTATTTTTATGAATGATGATGATTATGGTAGATGCATATTTAGTATTTTTACTGATTCAGTACCTTCCAATAGTTTTATGGTTTTAACAAGTCACTTCTGGGCTTATGAATAAGATTATGTAAGTAGAAGTAAGTAAATGGAGCTCATAGATTTATCAATACAAACTAACTCTTTTTTAGAAAATGTTAATCTTCCAGTTAAAATATAAAAGGCTGCTTTAGAAGCATCTCAGAAAAGCAATATTATATTGTAAGGTGATTTAAATTTACATTTAAAACACGAAGATTCGTTTATCTATAAATTTGGATTTGTAGATGTTTGGAGAGAAATTTATCCTCATGATGATGGTTATACTTGGGATGCTTAAAAAAACAAATTCGTAAAGAGTATTTACATTTTAGACAATAGAAGGATGAGATTAGATAGAATTTTACTAAGGAATCTATAGGGTTCAATTTATGCTGCAGTGATCATTACATGTTATTGTCTGAAATTTAAATAAACAAAGAGCCTAAAATTAATACAATCTACTAATATAAATAAATTCATCAACAGGTACTGA