TTHERM_00483490

Length: 696 bp

cDNA Sequence

ATGTCAGCAAAAATAAAATCTACTTTAAAGTTTGTCACGGAAACATCAACCAGAAAAGAAGATTATAAAAAAATGAATACAGTATTATAATCACTATTTGATAATAGCGACTCTCTAGAGTTTAGATAACCTGTGGATTACTTAGCTTTAGGATTAACTGACTATCCAAATGTGGTTAAAAAGCCAATGGACTTATCTACTGTTAAAAATAAAATAAATACACAAAGTTATGACACAATAGAAGACTTTTTAGATGATATTTAATTAATTTGGGATAATTGTAAATTATATAATGCTTAAGGATCTTGGATTTGGAAGTTAGCAGATAAATTAGACAAGTACTATAAAAAGCTTATAAAAAATTATTTGCCTATGGTCCAAGTTCAATAAACAGTTGGAAAAAAAGAGAAGAAAGATGATAAAGCAAGCAAATAATAAGATGTGTATATTGATAATTTTTAAGAAGAAAAAAGCTCATTTACTGCTAAAATTAAATAACTTACAGAAGAATAGTTAGGTAGTATAGTAGAATAAATTAGATTAGAAAATCCTTAAGCATTTATAAGATTAGATAATAAAAAGTTATAAGTTATTGTTGATAGCATCAGTTTTGAATCTTTATAAAATTATAATACTTAAATCGATAACTGGTTAATCCCTGTTAAGACTACAAATAAAAGAAGTAAAAATAATTGA