TTHERM_00486640

Length: 903 bp

cDNA Sequence

ATGGATAAACTAAAGCAAAATTAGGAATCACAAGACTTATCTTAGCTAATAGATCTACTAGATAGTATCTAGAAATTGAGCTTATAAAGTGCAAATTTACTTGATCCATTTTAATAAAGTGTCATAGACTCTCTAAAAAAAATTAAGGAAGCAGAATTAGCTATTAAAAAAAAGAATGATGTGTTTGACTTACCTAGTTTAGTCTACAATTAAAAAATTGATGCTAGAATTGTAAATAACCTATTCATAGAATTCTAAAATTAGGACAAAAATGATGTATTTAGACTAATATTTACTTCATTTGCTTTGAATTTACCTTTTGATTCGATATAAGATGACTCACCCTTCAATTCATAAAATATGAATGAAAAGTTAGAATATGTGGAATAGATTTTATTCTAAAAAGAACCTATTAAAATTTAAATAGAAGATAAATTTATTACATCAGAACAAGCTAAATAAGTTGTAATGTAAATAATTAGAGAGCTAGCTTAAGAATCTAAAACCAAAAACTTTTTGTCATTATGCTATAGCTTGATAAAAAAGATCTAAAATAAAATCAATGATTTGTGTGTAGTAGCTCTAATGAGATCAATTATTTTTAACGCAAAAGAAGATAGCACGCCTCCTTATCTTGAACTATTGGATATTTTTTCTGAACTTAATTCTAAACCTTGTATTTAGGATTAGAAAGAATTTTGGTGGAAAGTGTGTAATGCTTTTTCCTGTTATATTTATTTAGGATAAGAAAACTAAAGTCCTAAGAAATTAGGATATCCTGCAATTCCTGATGGATAACTTTAACTCCCAGATATGTTACTAATTAAGTAAAATAATTAATTGAAATACATAATTAATGAGAATTTCAAACCTGTTTATATAAAAAAAAATAAAAACAAATGA