TTHERM_00486790

Length: 1938 bp

cDNA Sequence

ATGGCTGAGCAAGAAAGTTCATTTTAGGGATCAGGTCTTTTTGATAACCTTAGAAAGTTAATTAACGTCATCGATGAATTAAGAGATGTCGGTTTACAACAATATATTAGATTGCCTAGAATCGCAGTTATTGGTTCTTAATCATCTGGTAAATCATCTCTTCTCGAAAGTATCGTTGGTATCGATTTCTTGCCAAGAGGTTCTGGTGTAGTTACTCGTAGACCTTTAGAACTCAGATTAGTTCATGTGCCTCCCAATGAAAGATAAATCAAGCCATATGCTATTTTCGATGTTGATAAATCAAAGAAGTGGGAAAACTTTGATTAGGTTAGATAACAAATCGATTTCTTAACTGACCAAGTTGCAGGTAAGAGAAAGAAAATTATCAATGACCCTATCGTATTGACTATTTACTCAAATGATGTTATCGATTTGACAATTATTGATTTGCCTGGTATTACAAGAATTCCCTTAAAAGATTCAGACCAATAAGAAGATATCGAAAAAGTTACTAAAGATATGGCTTACTCATACATAAAAGATGAAAGAACAATTATTTTGTGTGTTGTTCCTGGTAACTAGGATATTTCTAACTCCGATGGTCTCTAATTAGCTAGAGAAGTAGACAGAGAAGGCAATAGAACAATTGGTGTTGTTACAAAACTTGATATCATGGATGCTGATACTGATGCAAGAAAAATGATCATGGGTCTTGAAATTCCTTTGAAATTAGGATATGTTGGTGTCAAGGGTAGATCTCAAAAGGATATTAATGACAATAAGAGAGTTTCTAAAGCTCTTGACGAAGAAAGACTTTTCTTTGCTTAGCATAAAGTATACTCAACTATGGATCCTAAGTTCTTAGGTACTAAAGCTTTGACTAATAAGTTATCAAGTGTGCTTTTCTATCACATTAGAAATATTTTACCTGCTATCGTCAAGGAAATTAAAGATAAATTGAAAGAATGTGAAGATAGACTTAAAGACTTGGGTCCCTCTCTTCCAAGAGAACAAAAAGATAAAATGCAACTTATCTGGACCATGATTACTGATTTTACTGAAAACTTTAAAAATACAATTAAGGGTAAATACGATCAAAGACGTTCTAATATTAATACAGAATTATCTGGTGGTGCAGTTATTAAGATGATGTTCAATGAGCTTTATGAAGATTTCATTTAAAAAACCTTTAGAGCAACTAGAGAATATAGCGATAAAGATATTTAAACAGCTATTTAATTGCATTAAGGTGATTCTATTCCAGGTTTCCCCTCAATAGATGCTTTCTTATATTTAATTAATCCTCAATTAGAAAAGCTAAAAGACCCTGCCTTTGAATGCTTAACTTAATGCTACAATTATTTGGAAGGTTTAGCTAATAAGATTTTGAAGAAAATATTCTCAAGATTCCCCACTGTTATGGACGAAATTGCAGATATTACAAGCAGAGTGCTTCAAGCTTAAAGAGATTAAGCAAAAGAAGTTGTTAACAATATTATTGAATCTGAATAAGGTTACCTTTTCACTAATGATTTAGGCTATCTTGCTCACAGAACTCATTTGATTCCAGCTCAAGAATCTGGTAAAGAAGGTTAACAATAGATAGATGCTGAAAAAGCTTTTATTAATGAATTGAGATCTAGAGTAGACGTTTACTTCAATATCGTTGTCAGAAATGTAAGAGACTCTATTCCTAAGGCTATTGGTTTCTTCTTAGTTAAGGCTGCTTAAGAATAATTGTAATATTAATTATATAATGAAATTATGAGAAGTGAAGATTCTCTTGGTAGCATTGCAGAACCTGCCAACATCGCAGAAGAAAGAGATACACTCAATAAAACTATCGAAGTTCTTCAAAAGGCTCATAGAGTTATTAAGAGAGATCCTGATCTTCAACCCAGATATGATGGATAGAATCCTTAAAAGCAAGTTGTTTGA