TTHERM_00487110

Length: 735 bp

cDNA Sequence

ATGAACGATTTATCAGTCACAACTTTCACTCAAGACGGCTATATTAAGTAAGTAGAGTATGCACAAAAAGCAGTCAGCGATAGCGAAACTATTTTAGGTGTAAGATGTAAGGATGGTGTTATTTTAGGTGCTGAAAAGAAATTATAAACTAAACTTATGGTTGAAGACTCTGACAGAAGAATTTATAATATTTAAAAAAATATCGGAATGATTGTTGGTGGTAGAATTCCAGATGGTAGAAATGTAGTCCATAGAGCTAGAAAAGAAGCTTAGGAATACGAAAAATATTTTTCTATGCCAATTTCAGGAAGAATTTTGTCTGAAAGAACAGGATAATATCTTCATGCTCACACTTTATACGGAGCCTACAGACCTTTTGGTTGCTCTGTTATTATTTCATCATATGATCCTATTGATGGTCTTCAATTACATCAATCTGATAACGCTGGTTACTGCTTAGGTTATTATGCTTGTGCTTAAGGATAAGGTAAACAAGAAGTTATGGCCCATTTCGGTAGAAGAAATTTTAGAGATTTAACTTGTGAAGAAGCCCTTCCCTATGTTATATTAGCTTTAAATAAGGCACGTAAAGAAGCCAATGAAGGTATTTATCAATATGAAGTAAGTTGGATCACTGAAAAGAATAACTATGTTCATTGCCATGTTCCAAACGATATTAGAGACTCTGCCCAAGTTCAAGCTGAAGCTATGATTGAAGCTGAAGATTCTGCTTGA