TTHERM_00489480

Length: 5487 bp

cDNA Sequence

ATGATTAAAAAATTAATTACACTTTCACTTGCAGTAACATTCATATTCGCTGATACAACTAGTCCAGGTTTAGAGGTTTAGTGTAATACTTCTGATTAAACTTTATGTGGTTCAGCTGGTGGTAGTAGCTGGATTGCAGGTTCATCTGGCAAATCAAAAATTTCTGATTGTAGTGCCGCCAATAGTTTAACAAATATTTATGACACTTTTTGCTTATCTTGTGATTCTTCTCCCTTTGCTAATAGCGGACAAAATGGTTGTCAAAGTACAGCTGCTAGTGTAGGATTAAAAGTTCCATGTTAATAAAATGATAATTGTAATAGCTGTGGTACAGTTTCACTAGCTTTTGTATGGTCTATACCCTCTAGTGATTTAAATAATTGCTAAATAGCATCATGCTTAGCTGCTCCTTTACCAACTTCGAATTTAAATGATAATTTTTGCTAATCATGTGGTGGTACTAATATATTTGCTAATACAGATAAAAACGCCTGTATATTAAGTAGTAACTCTTGTATCTCTAGAAGTAAAAGTATCCCTTGGGATGATGGGGACTGTAACAAATGTAATACTGGTAGTACTAGTAATGGAACTAGCTTATACGCTAACAGTGATGGTTCATCTTGTGTTGCAGTCCAGAATTGCTCAAGACAATCTGGTTGGAATGATACAGATTGTAATGCTTGCCATATAAGCACTAGCACCCCAACATTATTATATGCTAATAGTGATGGCTCATCATGTGTTGCAAGCTCAAGTACTTGCTCAAAAATCTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAAGCAGTAGCACCCCAACATTATTATATGCAAATATTGATGGTTAATCTTGTGTTGCAAGCTCAAGTACTTGCTCAAAAATCTCTGGTTGGAATGATGGAGATTGTAATGCTTGTCATGCAGGCAGTACCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAGAATTGCTCAAGACAGTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAAGCAGTAACACCCCAACATTATTATACACTAATGCTGATGGTTCATCTTGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGTACCCCAACATTATTATATGCTAATAGTGATAGCTCATCATGTGTCGCAGTCCAGAATTGCTCAAGACAATCTGGTTGGAATGATACAGATTGTAATGCTTGCCATATAAGCACTAGCACCCCAACATTATTATATGCTAATAGTGATGGCTCATCATGTGTAGCAAGCTCAAGTACTTGCTCAAAAATCTCAGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAAGCAGTAGCACCCCAACATTATTATTCACTAATGCTGATGGTTCATCATGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGTACCCCAACATTATTATATGCTAATAGTGATGGCTAATCTTGTGTTACAAGCTCAGGTACTTGTTCAAGGCACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAGGCAGTGCCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAGAATTGCTCAAGGCAGTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAAGCAGTAACACCCCAACATTAATATACACTAATGCTGATGGTTCATCATGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGTACCCCAACATTATTATATGCTAATAGTGATGGCTCATCTTGTGTTGCAAGCTCAGGTACTTGCTCAAGGCACTCTGGTTGGAATGATACAGATTGTAATGCTTGTCATATAAGCACTAGCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAGAATTGCTCAAGACAGTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAAGCAGTAGCACCCCAACATTATTATACACTAATGTTGATAGTTCATCTTGCGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGTCATGTAAGCACTAGCACCGCAACATTATTATATGCTAATAGTGATGGTTCTTCTTGTGTTGCAGTCCAGGATTGCTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAGGCAGTGCCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGCGTTGCAGTCCACAATTGCTCAAGACAGTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAAGCAGTAACACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAGAATTGCTCAAGACAGTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGCACCCCAACATTATTATACGCTAATATTGATGGTTAATCTTGTGTTGCAAGCTCAAGTACTTGCTCAAGGCACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAAGCAGTAACACCCCAACATTATTATATGCCAATAGTGATGGCTCATCTTGTGTTGCAAGCTCAGGTACTTGCTCAAGGCACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAAGCAGTGCCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAAAATTGCTCAAGACACTCCGGTTGGAATGATGCAGATTGTAATGCTTGCCATACAAGTAGTAGCACCCCATAATTATTATACACTAATGTTGATGGTTCATCTTGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGCACCCCAACATTATTATATGCTAATAGTGATGGCTCATCTTGTGTTGCAAGCTCAGGTACTTGCTCAAGGCACTCTAGTTGGAATGATGGAGATTGTAATACTTGCCATGCAGGCAGTGCCACCCCAACATTAATACATGCTAATAGTGATGGCTCATCATGTGTTGCAAGCTCAGGTACTTGCTCAAGACACTCTGGTTGGAATGATGCAGATTGTAATGCTTGCCATACAAGTAGTAGCACCCCATAATTATTATACACTAATGCTGATGGTTCATCATGCGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAACACCCCAACATTATTATATGCTAATATTGATGGTTAATCTTGTGTTGCAAGCTCAAGTACTTGCTCAAAAATCTCTGGTTGGAATGATGGAGATTGTAATACTTGCCATGCAGGCAGTACCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAGAATTGCTCAAGACAGTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGCAAGCAGTAACACCCCAACATTATTATACACTAATGCTGATGGTTCATCATGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGCACCCCAACATTATTATATGCTAATAGTGATGGCTCATCATGTGTTGCAAGCTCAAGTACTTGCTCAAGGCACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAAGCAGTAGCACCCCAACATTATTATACACTAATGCTGATGGTTCATCATGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGCACCCCAACATTATTATATGCTAATATTGATGGTTAATCTTGTGTTGCAAGCTCAAGTACTTGCTCAAGGCACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAGGCAGTGCCACCCCAACATTAATACATGCTAATAGTGATGGCTCATCATGTGTTGCAAGCTCAGGTACTTGCTCAAGACACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAGGCAGTGCCACCCCAACATTTTTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAGAATTGCTCAAGACACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGCAAGCAGTGCCACCCCAACATTATTATACGCTAATATTGATGGTTCTTCTTGTGTTGCAGTCCAAAATTGCTCAAGACACTCCGGTTGGAATGATGCAGATTGTAATGCTTGCCATACAAGTAGTAGCACCCCATAATTATTATACACTAATGTTGATGGTTCATCTTGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGCACCCCAACATTATTATACGCTAATATTGATGGTTAATCTTGTGTTGCAAGCTCAAGTACTTGCTCAAGGCACTCTGGTTGGAATGATGGAGATTGTAATGCTTGCCATGTAAGCAGTAGCACCCCAACATTATTATACACTAATGCTGATGGTTCATCATGTGTTGCAAGCTCAGGTACTTGTTCAAGACACTCTGGTTGGAATGATACAGATTGTAATGCTTGCCATGTAAGCACTAGCACCCCAACATTATTATATGCTAATAGTGATGGTTCATCTTGTGTTGCAAGCTCAGGATCTTGTTTAAGAAAATCTGGTTGGACTGATTAAGATTGTAATGCATGCAATGCAAATACTTCCAACTCAACGTTTATATACGCAAAAGCAGATTAATCTAGCTGTTAAACCTCAGTAGTGTAAGGTACTAATGTGTAATGCTAAAGTAATAAATCTTGTTCTAATTGTGGCAGCTTCACTAATTTTACTTTCCTTCCATCAGGATCAGATACCTAAAATTGCTATATTAAGTCTTGCTTAGCTGCTACAATGCCTACAACTAATTTGAATGATTATTTATGTGGTTCCTGCAATCAAAGCAACAAATTTGCAAATGCTTACAATACCAATTGCGTAAATTCAACAGGAACCTGTAGTAGAAATTCTGGTTGGACTGACTCAGATTGTAAAGTATGCTATGCTAATGGCACTAATTCTGCAAATCAATATGCTACTGCAGATTAAAAATAATGCATCTCTAATAAACCTAGTTAGTCATCAGCAGGATAAACATCATCATTACCCTCATCATCTATTATATTAGCTTTTTCAAGCTTAATAATAGCTTGCTTACTTATTTGA