TTHERM_00490750

Length: 2331 bp

cDNA Sequence

ATGAGTGACGATATAAATAATAAATTGGTTAACTATTTAATTCATAAACCAAAAGATTAAGTTATAGATAAGTTTGAAGAATATTTTAGCTTTCTCAATAATGACGAGCCTTCATGGATTTTATACGAAGGTATTTTATATCCTTCAGTAAGTGTAGCATTTTAAGGGGCAAGAGCTTAGGATTTTGAGATAAAGTAGAAAATAGCAGATGTAGATTCTCCTGATGATCTCATATTACTAGCTTCTGAAATCGAAGATCCTCCTGATTGGGAGAATAGAAGATTAAAAGTCATGGAAATTCTAATTAGAGATAAATTTCGTCGTTCTCTTGAATTGAGAGAGAGATTAAGACTAACTGAAGAAAAGTAGCTAGTTTGCAGATTTTTCGAAGAATCACCTAGTAATTTGTTTTGGGGTATAGTTGGAAGCAAAGGATAAAATTAGATAGGAAGAATTTTAGAAAAGGTTAGAGGAGATATTCATTAAAATGTTGATTTGAAAAAGTGGATGTAAACTAAATTTCCTTTGCAATAGGACAAGATTTTGTTACCAGTAATCACTTTGAATGTTTCAAAAGATGGAGAATAGATTGAAACTATAACATTAAAAGAAAGAAGTTATTATTATATGGGCTAATATAAAACAAATAGCGTTATCCTGGCTCATCCAAGTATTTCTCGTTTACACGCTTGTTTGATCTGTGAGGAAGGTAATAAAGTTAGACTTGTTGATATGGAATCTAAATCAGGTTCTTTTGTTAATGGGGAGATATTAGAGAAGCTTTTTGATAAAGAATTGCAGACAGGAGATATTTTGACTTTTGCTTTATCTACTCGCTCTTATGAGATTAATATTGATTATACTGCAGCTAAGTAAGAGTTGCAAAAAAGAAGCATTCAATTACAACAGTAAGTTAAGCAACTTTAGAAATTGAACTAACCTTCGATTACTCCTGAAGAACTTCGTAGAATTATGGGATTTGATATTGATAATACTTTATTTATCAGTGGATTACCTGATAATGCTACTGTTTTAGGTATTAGAGAAATGTTTGAGAGAATAAGTGAACCTAAAAACAAGGATGAAAATGAAAAGAAAAAATTTTAAGGAATTAAAATCAAAGTTTAAGAAGTAAAAATTCCTGTTGACAAGTGGTCAGGAAGACCAAAAGGCTTTGCTTATGTTACATTTTAGACCAGGGAAGATTTTAATAATGCACAATTGTACTCCTTTGGTTTGAAGTATGGGGAAGTAAAGCTTAAAGTTAAGGTGGCAGATAAGGATAAATCTGCTTAATTAATGAATATTTGCAAGATTAAAGATGGAAATAATAACGATGAAGACTCTAAAAAAAGATACGATGATAAAAGAGGCAGTGAAAGAAGTAGAAGAGAAAGAAGTTCTGATAGACATAGGGATAGAAGCTCTGAGAGATATAGAGATAGAGACTCAAAATATAAAAGAAGATACAGCAAATCTAGATCAAGATCAAACGATAGAAAACTTAGAGATAAGAATAGAGTTAGTAAGTTTGATAATAATAACCAAGACAAAGAACAAAAAAGAGAAAGAGAAGAGGTTAAAAATGAATAGAATTAGGATTTGGAAAAAAAGCAAAATAGTGAAGACGCTTAGAAAAAAGAAGAAAAAGAGCCATCAAGCAAAGTTAAGGAAAACAAAGATAAAAGAAAAAGAAGCGACAGTAGAGATAATAACAAAAAGTAAGACAAAAGAAGAGATAGATCTGAGTCAAAGAGCAAAAATTAAAAATCATCTTCTCGTCATGAAAAACACAAGAGAAGAAGTTAATCTCCTAAATAAAAGAGAGGTAGCTCTTAAACAAAAAATGAATCAAAAAAATCTACTAAACATTCTAGAAGCAGATCAAGAGAAAGAGAAAGAGATAGGGAAAGAGATAGAGATAGAAAAGATAACAGAAAGAGTAATAAAGATAGCAGAAAATCAACTTCAAGAGATAAAAAATAACATAGAAAGAGCTCATCTAAAGATAGAAAAAAACAAGATGAATAAAATAATAAGTCAAACAAAGCCTCAGAGTTACCAAAGAAAAGTGATAAATAAGCTGATAAAGATTCAAAGGCTAAAACTGATAAACAATTAGCAGAAAAACAAAGCGAAAACTAAGTCAGTAAAAGAGAAGAGAAAGAAACAAACCAAAAAGCTAAATAAACTAAAGAAAAAAAGAGAAAAGAAAGTGTATCTTCAAATTCATCTTCATCTTAATCTTCAAGATCTTCATCTTCTTCAAATTCATCTAATTCAAGATCATCTTCTTTTTCTTCTTCTTCATCTTCTCAAAGCAGTAGTTGA