TTHERM_00490830

Length: 1992 bp

cDNA Sequence

ATGTCATAGGCACAACAATTAGAGTTAGTCGAGGATGAAGAAATAGATATCATATAAGATGATTAATTACAAATACAAAGTAGGAGTTAATAAGTAGTGATTAAAAATGAAAGAGAGTTTGATTGGGTAAGGTATAAAACTGAGGAGTGTTGCGATAAAGAATGTGCTTTGTTAGATAAAAAGAAAGAATTTGTATTTCCCTTATTATTTAATTGCATAAAGTGGCACAACCAATTTGATAAAAGACGTAAAATAGTTGTTAAAGACAAAAATAAATTCAATTACAGCAGGCTTTTTGTCAAGGAAACAGATAGAGAAGATACAAGATTTTGCATGAATTTTTTTGAGTATTTTTATCATCCTTAAAATTTCAGATCAAAAGAATGTCCTTCTGTAGCAGCTAATTAAAATTTGAATGGAACAACAGAAAACAGTAATTAATTAGCAAAAGATAAGCCAAGTGTATGCATTTATGGAATATTTTGTCCTTACTATCACAACTAAGCAGAAAAAAATGACTGGGTAAATGATTTAAAAGCCACTAAATACATGGCAGCACCCAAAGAAAAATTCACATAGAGTTTACTTGATGACTTTAACAATATTTAATCTAGTAACAAGCAGTTAGAAAAATTATACGAGCAAATCTCTCAGTAAAAGGTAGTACCTAAGAACCAAAACACAAATAGCAATAACAATAACTCTGTGGATTAAGTAACTCCAATTTCTAAGAATGAGCCTTCTCCAAAAGAAAAATTAAATATGTAATTAGCTAATATAGATAAGATTTAAGATAATAAAATGACATAGAACACAGCAAACATTCTTTTAGATTTATACGACGATGATAGTATTGTAGATAGAAATGATATTTTGATGTTAGATCCAATAAATGAGCTAGAAGAAAAACACACGAATTCTAAAGGCAGTGACTCCAATCTCTAAGGTAGAACTAGTAAAGTAGATAAATCAAATAAAAAGATATCTTATTCCCCAAAAAGCAAGACTATGGTAAACTTAGAGTAAAAAGAGACAAAGAAAAAAACTTAAAATCCTCCAAACAAAAATGATCAAAATACTCCAGTAAATTAAGAATTTAAAAACTAAGGCGATTTATCAAACAAAAACATCGATATCCAAGTTGCAGAATTAAAGATAAAGCAAGAATAAAATTAAAATAAAAAGTCTAAAAAAAATAATGAATACTAATTTTAAGACATAAGACACAGTTCTAACAGTCTTAATAATCCAGACACAAAATCAAAGAGCGAATTAGATATAACAAAACAAACTTCAAAATACACTGATTTGAGCTCCAATGATGAGTATCTTAAAGATTTTACAGATGTTAATACCCAAAAATACAGTAACAAGGTTTATTATTATAAGTAAGACTTAGGTCATGAAAGTTCTACAGTCGAATTTAAAAACTACTAGAAGATATCCTCATGTAAAATCTAAAAAGACATGATCGCTATATTAAAATTGCAAGAATATGGTTAATATATTTGCGGTTTCTTAAACCACAAAGGAGGAACAATGTATATAGGTGTGCATGATGAAGGTTGGGTAGATGGTATAAGCTTGAATGCTAAGTAAAAGGATTGGTTTAATTTGTATATAGATTATATAACTTCTTTAATAGAACCAAGATTAGTAGTGGGAGAAGTGAGAATCAACTATACTGAAGTAATTGGAAAGCCTGTGTAGCTTAGTAAAGACTATATATATTTCTTTGAGAATAATGCATATATTAAAAAATAATCTTCGAATGCCAAAATGTCAATACAAGAAATAAAATAAGACTTATAAGTTAAAATAAAAAAGCAACTCAGAGCAGAGTGCAACCAAATCTAAAAAATGTTTCTATATGATGATTTGAGCGATTTAGATTCTTAAAATTTAAAATAATTGTAAAAATTAGAAGAAAAGCTTAAGTATGTATTAAACTAGGTTTAGATAAAAATAGAAGAAAAGAAATAAGAAAATTGA