TTHERM_00497120

Length: 1344 bp

cDNA Sequence

ATGATTGGATTATTTGGTAAAAACATTTTAAAGTTTGGTAGAGTCTAAGCACTTAATACTGGAAAATACAGCGCATTAAGCTTAATGAACACTAGCTTAAACAAAAATATTCCCAGAAATTATATAAGAATGACAAAATAAGATGCTGTATAAATTCCTTCTGTTGAAGAAGCAACAAAATACTAACAGGATTTTAAGCTTGATGAAACTGTTACAAACCCTGTCCATGATTTAGTTAAACCTGGAAAAGAAAAATTAATAGGTTCATGGCTATTATTGACTGCTGCAGGTGTTTTTGGAATGATAGTTTTAGGTGGATACACTCGTCTTACCTAATCTGGTCTTTCTATGACTAAATGGAAACCAATTGATCACAAGCTTCCCTCTACATAAGAAGAATGGGAAAAAGAATTTGATAATTATAAAAAATATCCTGAATATTAACTTGTTAACAAAAATATGGATTTAAATGGATTTAAGAAAATATTTTTTGTTGAATGGGCTCACAGATTATGGGGCTCCTCTTTAGGAATCTTGTTTGGTGTTCCATTGTTAGGATTTGCTGCCTTAGGATGGTTAAAAAAGCCCATGTTTTTCAGATTAACAGCTATGCTTGGTTTGGGAGGTTTACAAGGATTAATTGGCTGGTGGATGGTCAAGAGTGGCTTTGAATAAAAGCCTGATTACTAAACTAAGCCAAGAGTTTCAGTTTATAGATTATTCACTCATTTGAATATGGCCATAGTTCTTTATGGAGCATTATTATGGAATGGTTTAACTTTAATTAGAAAACCTTAATAATAAGCACTTTAGCTCTCTCACTTAGCTGGTACTAAGACAATGAGAGGCTTAGGTATTGGTTTATTACATTTCGTAGCTTTGAATATTATGTCTGGAGCTATCGTAGCAGGAATAGATGCTGGAAAAGGTTTTAACACTTGGCCTGACATGAATGGCTAAATGATTCCTGATGGTTTGATGAAAAGAGATCCTTGGTACTTGAATTTCTTTGAAAATAGAGTTTTAGTCTAATTTAACCATAGAAATTGTGCTTATTTGACTGCAAGTTGGACAGGATACATGCTTTACAAAAGTTTATCCCTTAATTTAGCTAAGCATCAAAGATTCTAAATTGGTTTACTCTCATTCTTTATTTTATACTAAATTGCTTCTGGTATAACAGTATTATTACACGGAGCACCTCCAAAAGAATCTTCAGGCCATTAAGCAACAGCTTTGATGACTGTAACTGTTGCCCTTCTTACATGTCATTCATTTAGAAAGCCTTCAAAGCAATATTTAAATTACGTTCAAAAGTTTATTTAATCATAAAAAACTATTTGA