TTHERM_00502440

Length: 1251 bp

cDNA Sequence

ATGATGCTTAAAGAAAAAGTATAAAAGAATTTAAGTCAGTTAAACGAATTATTTAGCGAGTTAAGTAAAATATCTTTAAATATGAAGACCTATGTAGTTATCCTTGAAGATCTTTATAACTTGCTAGAAGAATCTACATATAAGGGGGATCCATAGGATCTTGAAAGGCGAAATGACTTTGAGGAAATACAAGATAACAATATTTATGTGGAAGATTATTTAAGCTCTTCTCTAAAATATTAAATCGAAAAGGATATAGACACATGCTTCGCAGCTTGCGAGCAAATATATAAAAAGTAAAAATCAAGTCTTCTAAAGAAAACATGGCAATACTTAAAAATATTAATATTTGATGATCCTGAAGAAGTATTACAAAATGAGAATTTCTCCCTTCTATAAAAAGTACTTAGGGTAAGATTAGAATTAAAAGAAAAGAATTTTGCTATCTTGTACAAAGAGATAACTGAATTGAGAGCTAACTAAGAATATCAGTATAAATATAAGCGCATATCTGAAGAATAAACTGAGCATAAGCAATCAAAGCCTTAGTAAAAAATGAATACAGTTTATAATTTAAAAAACAAAAACAATTTAAGTGGTGGTGAGATTTTGGATGAAAAAAGTAACGATAATTAATTGTCTTTTGAAACTCCCCTACCTCCAGATGCAAATAACAAATTTAAGAATCTTGGTTAATATTTAAAACCAAATAACTCCACTTCACAAAACTTCTTTGCCTAATTAAAAAAAGATGATCAAAGTTCTAATAGCAAATCAAAACCAGAAAAGACATAGATAACAAGCATCAAATATAAATTAGAACCATAAACACATGAATCATTATATTGCTAAGATAATTTTTTATAAGAAGTATCTATTTGCAAGATTATAAACTTGAGCGAAGACATGGATGTACATGAATAATATTCCTATAAAGATTTCTATTAATTTAAAAGAGCTTAGTATATTGAGTTATTAAAATCTAGACAATAAGATTTAGGAAGAATTTCTAGAAATCATGCAAGCTTGAGAGTAAAGATTAACAATGACAATAATTAAGTTGGATTTTACTTAGTTAATCATAGTCCAAATGGCACCTACATTTAAAAATCTGGCACCACAGAATGGATTAAATTGAAAGAGGTAGGTCAAGAAAGTTAAATTTTTGAGGGTGATCAAATAGGACTTCTATTTGACAGTCAAGATCCAACAATGTACCTAATAGGCTACAAATTCTAATTAATTGAATGA