TTHERM_00502620

Length: 924 bp

cDNA Sequence

ATGATAAAAATACATTAAAGTCCCTTGCTTATGCTTAGAAAAATATAAAAAAATTTGTAGAATTTAGGTGTTATATACAAGTATAAATAATGTTTTTCTGATACCTAAAAGATAATTAGCTTTGAATCAGATTAATGGAACTCAATTCACGTTAATATCAAATAGATTCCATAAGAAAAGCAATTATTTAGTAAAATTTTAAAAAATTCAGAATAGCAATGGCTAAGCGATTAAAAAAAAGCAGTTTGGCTAAAAATTAATGTTGACCAATTAGAAGTATTATAAGAATCTATAAATTTAGGATATAAAATTCATCACGCAACAAGTGAGTATATATTATTAAGTAAATGGCTTTTAGAAGGACAAAAAAATAAACTACCAGGATATGCTAGTCATTATGTAGGATGTGGAGGTGCTGTTATTAACTCTAAAAATGAAGTATTAATGGTTTAGGAGAAATATGGATATAATACTGGTATATGGAGCTTTCCTGGTGGGAGAGCTGATCCTAACGAAGAGATAAACTAAACTGCAGAAAGAGAAGTATATGAAGAACTTGGTATAAAAGTAGAAGCTGTTGATTTGTTACTAGTAAGAGAAAGTACATAATCTATATTTAACAAACCTGATCTATACTTTGCTTTTTTAATGAGACCTGTTGAATAAAATCCTGAAATAAAGTTAGATAAAGAAGAGCTAAATAATTATACTTGGATACCTTTATCCAAAATCGACGAATTCATAGCAAAAGAGCGTGTCTCTACTTACTATGTTTAAAAAACAATTTTAGATAAAGTAAATTAACTTTACAAATAAGGATTTGACTTTTAAAATGATAGGTTGTCAATAAAAAACAGCTATTAAAATTATCCAAGAAATGGAACAAATTATATTATGTACTAGTTGAAAAATCCTAAAAATTGA