TTHERM_00522250

Length: 801 bp

cDNA Sequence

ATGGAGATAGAGACAGCAATAAACCAATTAAAAATTGAAGGATAAAAAATAGAAATAGGTGAAAACGACTATGATTTTGTTGAAGAAAAGCCTAATGTATTTGAATTTAACTTAACAATAGCTGCCGATTACAAATAAAAGCTGCTTGGTGGTAAATTCTAAGTGAAGAAAATTATTTTTGCAAATAATGGCCACCCTTAAATATTCCTTCAAACTAAAGTAAACAAAAACAAAGATTTTCAAAAGGTAGCAGATTTGAATTTCTCTAAAAAAAAACAGTTATATTTAGCTAATTTCTACATCTCTACTTCAAATCCTGACTTACTTGTTGTAATATTTAATTATTCAATTGAAGAATTTGAATTCAAATTTAGTGAATTCTTCTTTTAGTATGTTGATGGCTCTCATTTGGAAAGTGTTGTTATCTTAGATACAATTAACTAGGAGTATATTATCTCAACTAAAAAAGCTACATAACTAAAAAATCCTGCCCTGTCAAAATTTACTACTTCGAACTCTTAAAGCAGCTCTTTGTTCCCACATATTGAATAAATACCTGTAGGTAACAGATTTTATGATATTACAGGTGATATTGTGACTCATTTAGAGTTATCAGGAATTAGAGGAGAAGTTTTACTCTTAACTCCAGTAGAATAACAATATGTTTTCAAAGATATTTAAGCATTTGAGGTTGTTCGCAGTCTTTATCCTTAATTAAGCTAAGAAATAGTAGCTCAAGATGCAAGACCTCTTATTCAAAAACTCAATGAAATTTTATACAACTCAGGAATGTTTATGTGA