TTHERM_00522820

Length: 1368 bp

cDNA Sequence

ATGGATAAAGACTCAACCTTCTCATCAGAGAAGTCTTTGATTGATAATGTATAAGTGAAGATTGATGAATTCAAAAAGTAGCAAGGACATCTTGATAGATATCATGAAAAATATAGATTAGCTAAAAAGCTTATTAAGGAATGGGGTAATTTACTTAAAAAGACTAAACAAGGAGCTTAGAAAATAGTTGAAACTTAGCTCAAAAATATGGATATTTGCTACGAAGATGAAGAGTCAATAAATGGAATAAACCAAATTTTAAATTTAGTAAAGGATATGATAAATATCTTTTCTGCTAAAATTGGATTATATGAAAATGAGCTATTGAAGTAGCATCTAATTTTAAAAGAACAAGGAAGTAAATTATACTAAATTAATAAACAAGTGAAAGACTCTTACAAAACCGAAAAAGAATTTTATGATCAAATAACTAAAAAATTTTAAGATCAGCAATGCAAAATCGTGAAGAACTCTTTTATAAAATTTAGAATGACTGAAACATTTCAGGAATAAAACAGTAAAAATGATAAAAGTGTTTCAAATGGCTCTACATCTCTTTTATAAACTAATTAAAGCTATATGAATACAACTGCAAACTCATTTAACTTGGTATTAGAAATGTTTAAATGTGAAATAGAGAAGTAAATGATTATGTCTTGCAATAAATGTATTTAATCAATATTGAGTATAACTAATGTGATGAAGCCTTTTGAATTTGAAAGTTTAAAGTCTCAAATTCCCAATTTTATTATTGAAAGAAATAAAATGCAATTAGAAGTGATTGATGAATTTCTAAAACGTTCAAGAGCCTCAAAAGAGATTAATAGCAAAATGATTTCTTAAAATCAATTGACTCATAGCTTTTGCTATCAAAATTTTAAGGAATTTTCATAGTAATTTCAGAGTACTTCATTTTAAAAGAAATAAAAAGAAAGCAGATTTTATAATCATGACTAAGCAATTGCTAATAAATCGCCATTTTCTTTATATGAAACAAATTTTAATCCATTCTCTCAGAATGCAGATATTGAATAATCTAATGTTGAAAAAATAAGTGTTTTGTAAAACATGTAAATTAACAAACTAAAAGAAAAAAATGAGCTCTAAATATCTGAAAAGCAGAGTTTAGCCTAATCTGAAATAAAATATAACTAGACTCCATAAAAATAAAATTTAAACACATCAAAAGAATCAAAACAAAAATTCAATTAAGCATCAAATTAGCAATCAAACTCACCTTATTGCAAAGAATTCTAATTTACCGTACATTAATCAGACCGTTAAAATGATTCATCAAAAGATCAAAAAACCAACTTGAAGAGACAATAAGAAAATAAACAAAATAGTGAATTACACAAATAAGAATGA