TTHERM_00526410

Length: 1239 bp

cDNA Sequence

ATGAGTTAGCAAAGCGGTAGAAATACTGCTAATTCTAAAACAGTTTTGAGAAAGCCATCAACTAGCGAAAAATCGTCCAAGTTGCAAATAAACTCGGTTCCTACTTCATAAGAAAAGATAAATTCTACTTAAAGCACAAGTTCTAATAACTTTAAGCTTCCCCCAACAAATAATTAAAATAACAAAAATGTAGTGTTAATTTAAAATGTAGCTGGAGATGGTTTATGGTGCACAGTAAAGGAAGATAAGTATGCTCAATAAGCTGAGAGGTTTATTGAGAAAAAAACTAAATAAGCAGAATCTAAAATAGAAAGTGAATTAGTAAGCACATTAGAAAAACAATGTTCAGATTTAGGAAAAGAGCTTGAAGTAGAAAAGATTAAAGTGCAAAATAAAAACATAGAAATAGTTTAAATGAAGAAAATTATAGATTAGCAAAGTGTGCAATTGCAAGAACAATCAACAGAAATTATGCATTTAAGAAATTCTAAAAAAAACTTAGAAGAATAGTTGGAGAAAACAAGAGATGGATTCAACCAGTTAAAAAGAGATATGAATAGAGTTTAATCTGACTCTACTTCAGAATCTTAAAAATCTAGCGATTTAAAAAATATATATCTAGAACTTAAAAAGTAATTTGAGGAATACAAATTAGTCATGAAATAAAGAATAGATGAGACTGAGTAAAAACTAGAAGAAACATTAGAGGAAAATGAAGATTTAAGAAGAGATTTACAAATAAAATCTGAAATATCTCAAAGAATTGAACTTGAAAGATTAAAAATGTATGAACAAAAGGAGCAATAAAGCATTAATGAAAATGAAAAAAGAATTGAAAAACTTACAAAATTATTAGAAGAAAATGCTGTTCTTAGCGAAAAACTTTCTGAGTCCGAAACATATAAAAGGAAATTCAAAGAAAAAAATATTTAATTGGAGAAATCACTAAAAGAAATACAGTAATAAAGAGATAAGATAGAATAGGCATATGTTTAAATGAAAAAAAGAGTTAATGATTTAAGTGTTTTAAAAACTACAAATAATAAAATCTTAGAAGAGAAGATCAAATCTCTCTCTAAGGAAAACGAAGATTTAACTGAAGAAAATAAAAAACTTAAAAAGTAGCTTTAAAGAAAACCAGCTGTAGTTTAAGATTATGAAGAAGAGGAATAGGAAGAGTTAGAAGAAGTTTAAGCAAAGCCATTCCTCTTTGGGCCAATAGATAATGGAAAATTCTGA