TTHERM_00529610

Length: 1344 bp

cDNA Sequence

ATGTATAAAAACATTTTCACCAAATTTACAAGCTCAAGCAGCATATAGTTATCAAATAAAGTAAAGCAATGCTTCTCATTAAAAGGCCACACTATTGATATTTAAAGCGAACACAATTTAATTTAGAGAAAATCAGATTTTGAATAATTGTATAAAGTTAAATACACTGATAAATTGGTAGGATACGCTACAGCAGAAGGAACTAAAAAATATTCAGAATTGAAAAAAGATTCTGTTGACCCAACTAATTTTAGCACTCCCTTTAAGAGCGATCTAACTTTAAGCAGTATAGGTTTTGGAAGCTATTAGGGTACTCCTGATAAAGAAGATGATATGAAGATGTTTAATGCCTTAATAGACTCAGTTAATTCTGGTGGTATTAATGTTATTGATACAGCATTAAATTTTAGATACTAAAAATCAGAAAGATCAATAGGTGCTGCTCTCAGATATCTCAAAAATTAAAATAAAATTACTAGAGATTAGTATTTCTTAGCTTCTAAAGGTGGTTTTTTGGTTGATGATGCCGATTAAGGTATTCCTAGTACTGTTCTTATAAACAATTTGATTTAGAAAAAGTTAATTACTGAAGAGGATATTATTGGAGCTTGTCATTGCATGAACCCTAATTATTTGTCTTAAAACATTGATCAAAGTCTTGACAACTTGGGTGTTGAAACTTTAGATTTATATTATTTATAAAATGCTTCTGAAGTCTAAATGCCTTTAATTGGTGAAGATAAATTCTTTGAAAAACTATCTTTAGTTTTTGAGCTGTTTGAAAAAAAAATACAAGAAAATAAAATTAGAAATTACGGATTAGCAACCTGGTTAGCTTTCCGCTCACGTTAAGATGAAAAAAATATACATTTAAATTTGTAAAAAGTTGTTAAATTAGCAGAAAAAGTAGGTGGTAAAAACCATGGTTTACGTTACATATAATTGCCAGTTAATGTGATGATGCCTGAAAGTTTTTCTGAAAAATGGTAAAATTATGAAAATGAAAAAGGAGAAGTGCAAGAATAATTCTTACTTAAAGTAGCTAGAGAATTATAAGTTAATATTATTACTTCATCTCCACTTATGTAAGGTGCTATGATTAACTGTCCTTTACCTAAAGATGTATTCTAATGCGTTAATCAAGGTGCCAAACATCTTTAATTTGTAAGATCAATTCCATCTCCAGCTATCATCAGTACCTTAATTGGGCAAAAATCTAACAGAAATGTTAAGAAAAATTTAGAAGTTATTGTCTATCCTAAGCTTTCAGAAGATAAATTTTGGGAATTCCTCATACCTTCTAAGAGAGAATAAGAAATAGAAGAAACTGTTAATATTAGTTGA