TTHERM_00532540

Length: 2955 bp

cDNA Sequence

ATGGGATAAAAACCTGATAAGCAATAACCCTAACCATCAATCCATGATAATTCCCAAAATCAAATAACTGAAAAATATGATTGTTTAAAAGAAAAATTAATTTAAGTGAAGTAATAAATCCATAATGCTTAAAATTAAGATAGTTTATTTATTTCTAAATGGGGTTTTATGCTCGATTATAATTTTGGTATTTAGCTGGGGTAGTTAATATCAAATTAGGTTTAATTAGTTAATTTAAAACTTGATTTCAGCATAAATAATTTACAATAAGAAGGTGTGAGAGCTTTGTTTGAAAATTTTAAGAATTTAAATTAGCTATAAATGCTAATTATCAATTTATAGGAAAATAAATTATTAGATGAAGGTGCTGCTGGTATTGCCAAAGGTATTTCGTTATCTTTTATTCAAAAGAAAAAATACTATTTCTACGAAAGGACTGAAAGACATGGCTTCAGATTTAAGCTCACTCTTTAATTTAATGATTCTTAAACTAAATTTCAAACGGTTTCGATACTATATCATAATTAAAAAGCTTATAATAACTAGAAATATCATTTCAGACTTGCTTAAATTAAGAGTTTAAATAGACTCGGTTTATCAATATAGTATATATCATTTTAAACTGACCAACTAAATTAATTTACTTAATAAAAATTAAGCCATAACAATTTAAACATTTGTCAAGAAATATCTAAATTAAATAATATTCATCGTCTTTCTCTTACTAATTATACTACGGATGTAGAAGATAATTTATCTTCTAAAAGAGAAATTAAAATTCAGATAGATCCAGGTTAAAAATTTGGATTTAATGAAGCAGAAAAGCTAGCATTAGAAATATTAGAATTATAAGATCTTCAGTCTATTGACTTTAAAATATCAGAAAAAAATAATTTTTGTGGAAAGAGTGTATAATAAATTACCAATTCTTTTTAGCATTTAAAAAATCTCAAGCAATTATCACTATCAATATATGATAATAACTTTAATAGCGATGCTAGCTTGATGCTTGGATAATCTCTCTCTAATATTCCATTTTTGATTTGCTTAAAAATAACTATTGGTCCTTAAAGCTCATTTGGCTAATTTGGAATGTAGGGACTTCTCTAATCATTTAGGACCATGAGGTAGTTAAATTCTTTGGCATTATGTATTGGAACAAATGATATACAGTAGTATGGAGCTAAATGTATTGGAGATTCTCTCTAATAGCTAATAAATCTTAAATCTTTGATTTTATAAATAGAAAAAAATAATAACATAGGATGCGGAGGTGCAATTGGAATCGCTCAAGGACTTTCATCTTTAAAAAATTTAAATGAGCTTTAATTATCTTTAGGATTTGATAATAGTATTAGCTCATTAGGTATGACATCTATAAGCAAAAGCATACAATAAATAAACAATTTAATTAGATTGTCTATATCTATTGGATAAATGAACAATATTAGTAGGGAAGGTGCGAAATCTTTAGCAGATACTATTAAGTTGTTAAAAAATCTTAATTTTTTAGAGCTTATAATTTATGATAATAATATTGGGCCCGAAGGATCGAAGGAGATTGGTTTAAGTATTGGAAATTTGAAAAATCTAACAGAATTGTAATTGCAAATTGGAACTAATAACATATCAGACGAAGGAGCATTAGGAATCGGAATGGGATTACAAAATCTAGATTAGCTTTCATGCTTGAGCCTCAAGATAGGACCGAATAATAACATAGGGCCATCAGGAGCTCAAGGATTAGCTTATGGATTATAGTATCTAAATAATCTTACAAAACTTAATTTATAAATCGCTTCTAGCAATAACATAGAAAACCAAGGAGCGAATGAAATTGGTAAAAGTATATAACTTTTGAGAAAACTCTACTAATTATCAATAAAGATAGGAAATAACAATATAAAAAATGGTTTTCTGATTTTGTTTAAAAACTTAAGATATTTAATCAACTTAGAATAATTAGAACTATAAATTGATAGCAAAAATATTATTAATTTGAATGAAATTAAAATACTTACTGAATCTCTAAATTAATTGAAATAATTGCAATAAATAGATGTTTAAATCTGTTCCCCAATGGCTTTATATCTGATCATACTAATAAAGGAATTAAGGCTAACTAAATAAAAGTTGTCAATTAAGTATCTTAAAGATTATAAATACATTGTAAATGATGAATCTAGTAGCAGCAATTTATAATAATAGTCTTATAGCTTATCTCTTTAAATACAAATAGATCAAGAAAGGAGCTTACCTTAAAGCATAGGGTTATTTGAAGGACTTTCAACCTATACTAATTTAACTTCACTCTCACTTAATTTTGGATATAATAATTGCATATCAGAAGAAGGTGCTTGCAGCTTGGCTACGTGTATTTCAAAATTTTTAAATTTGAGGTTACTTAATTTATATATAGGAAGCTTCAACAAAGTTAATAAAAAGGGGGCTTCTAAAATAGGAAATAGTCTCAAATGTTTGAATAATTTGGAATAACTCTAAATTAATTTTGGTGGATTCAATGAAATATAATCTCATGGTTTTAGATCTATTATTGATGGGTTTAGTTAGCTTTCTAGCTTAAAACATTTGGAGTATTAAGTTTTCAATCCAAACAACATAAATTCAAAAGACATTAATTATTTAGCATGTGCTATAAAATCTATGAATCATCTAAACAAGCTACAACTTAGAATTAATGATTACTAAAATATATACGAATCCAATTGTTTAATTGCTTTAGCAGAAAGCATATCTTACCTTTCTTCACTCAGGAGTCTCTCATTCAATTTGAATTAATGGCAGATGTTTGACCCAAATCTTTCTTTTGAATTATGTAGATTCATTTTTGATTTACCTTTCTTGCGTTTCTTACAAATAGAAGTGCCCTCCTAATTTAAAAAGTACACATAAAAAATTATTTTCCGCTGCAAAAGGCTAGTTGTTTTAAAATGA