TTHERM_00535680

Length: 1164 bp

cDNA Sequence

ATGACAAGCGCATAGACTAAAAAAAGCTCCATTGAAAACGATACAGTTTTTAACGGAGAAAAAGAAATTTCTGTTGGTGATATCAGAAAGTTTATTCCTGCAGAATATTTCGTTAAGAGAGAATCCAGATTCTTGATTAGTGTTTTATATTCTTTAAGCTTAACCCTTTTCACAGCTTTCTTAGCTGATAGATATCTCCGTTTAGAATGGGCCTATTTACCTCTCTGGATAGCTTATGCTGTTATCAATGGAACTATTGCTACTGGTCTTTGGGTAATTTAAATTATTTTTTAATTTGCTATTGTTATTTTTAGTATTAAACATAGTAGTCACGAATGTGGTCACAAAGCTTTCTCTAATAGCGATGTTGCTAATGACAGTTTAGGTTATATCCTCCATACTGCTTTATTAGTACCTTACTTCTCTTGGTAATGGTCTCATCATGTTCATCATTCTAAGTGTAACCACTTGACTGAAGGTGAAACTCACGTCCCTAGAGTAGATACTGACCCTAAAGCTTCTATGTATATCAAGCTTAGAGATATTATTGGAGTTGAATCTTTCTCCATCTGGTAAGTTCTTAACATCTTAGTTATCGGATGGCCTGCCTATCTTATTTTTGGTGCTACTGGTGGTCCTGCAAGAGGTTTCAGTAGCCATTTCATTGTTCCTAATAAATTATTCACAAAGGATAAGCTCTTAAAGGTTCACTTATCAAACCTTGGTTTAGTTATTGTAGGATATTTACTCTATCTTTGGGCTAGATAAACTTCTTTCACCTATGTTTTTGCTATCTACTTTGGACCCTACTTAGTCGTTAATGCCTGGTTAACTGGTATCACATTCCTTCAACATACTGAAGATACTGTTCCTCACTATGACAAGTCAGCCTGGAGCTGGTTAAGAGGAGCTTTATGCACTATTGACAGAAACTATCCTGAATACATTAACGCTTTACATTTTGATATTGGTAGCACTCACGTCATTCACCATATTTTCCATGAAATGCCTCACTATAATGCAAGAGAAGCTAATATCTACCTTAAATAAATTCTCGGTCCTGCTTACATTAAAGATAAAAAGTCTGTTACTAGAGCTTTATTTGAAGCTGGTAAATTAGCTTGTGTCTCTGAAAGAGAATAAGGTTTCTATTATTGGAAATGA