TTHERM_00543580

Length: 4656 bp

cDNA Sequence

ATGAATAAAGTTACTTTATTGCTATTGTTAACAGCTTTATTAGTAAATTCACAATTTACTGATAAAAAGGTTGTTAACTCTTGCTTACAAGACGAAATCGATATGAGTAAAATTGTTCCATAAGACTACTTAGAAACGTTTGATGAAAAATATGGATAAAGAAAGCTCCAAAGGTCTGAGCCCTAACCTTTTAGAATTACACTTGATTTTAATGAATTAGACAATCCTCTAAATGGAGCTGGAATGACTCCAAGTTTAAAAGAATACATTAAGAAAATTATGTATGCTGCTTAGACATTTTTGAACAAGCTCATTAAGGTACATCCTAGATAAAAACCAAATAAATATACTTGGTTTAATCATCTTTGTTATGATACATTACTTTCTGAATAGATAAAAACAGTTGGTGTAGATAATTCTGATTTACATATTTTTGTTACCTATGGTAATGAACGCGCTTCATATGTAGCAAATGCAATTTGGTGTAACTTAGATCCTAATCCTAATGTTGGAAGAGTTAAATTCAATTTAGGAAATATGTTTATAGATGAAACATCTGGTTAGTCTTTCTTGGATTACTTTTCAGTTGCCTTGCATGAAATTATGCATATCTTAGGTTTCTCAGGTAATAGTATTTAATATTGGATTGATCCTGATACAGGTAGCGCTTATGGTTACTGGAGTGTTGAAAAAATATTGAAAAAAGAAAGAAGATGGGATATTGAAAATGTAACAAAGATATCTTCTAAAAATCTTTTGAAAGTTTCCAGAAATCACTATAATTGTCCTTCAATTGATGGCATGTACCTTGAAAATTAAGGTGAAGGTGGCTCTTTTGGTTCACATTGGGAAAGAGATTTACTTGGAAATGAATTTATGACTGCAAGTACGGTCTTTGGCTACTATACTATATCTGAATTTACAGCTGCTCTCCTTTTAGATACTGGTTATTATGCTGAAATCAATCAAAATCTCCTTATGCCTCTTTACTGGGGTAAAAATAAAGGCTGTGACTTCTTCAATAAATCATGCAACGCTGGAAAGTACTTTGCTGAATTCTCAGATGATACTACCAGAGAAGGTTGTGATTTTTACTCTTATGGTATTGGTCGTCGCTATAAAACTGATCCATTCTCGTAATGTGAAAATATTGTAATCAGCATTTAAGGTAGATGTGATTCTGATGACTTTAAATCTGAAAACTTTTTCAGATAAAACCCTGGTGCTGGCTCTAGATGTTTTAGATCAAATTCAAATGCCAAAGGAGAAAACTTTTTGAATATTTAAGGCAGATGCTTTAAGGCATAATGTTCAAACGATTTATCATCAATTAAAGTTAATGTTTGGGAAAACGAATTTGTTACTTGCTAATACCCAAATTAAGTTATTAATTTGGCAGAATAAACTAAAACTACTTAAGGTGTTATGAAATGCCCTGATGATTTTGAATTGTTTTGTGGTTTCCCTAAATAATGCCCAAATAAATGTTCAAGTAATGGTATTTGTATTAATGGATTTTGTATTTGCTTAAAAGGATATGCTGGGGACGATTGCTCTAAAAGATGTGGTGAGGATTAAGTTTGGGATGGCGCACACTGCACATTAAATTGCCCTTCTGGATTATTTAAGAATTTTGATAACACTTGCAAGACCACTTGTCCTTATAAGTAATATGGAGATTAAGCAACACGTAGTTGTGCTGTTTGCTCTAATAAATGTTCTGCATGTTTTGGTCCCTCTTCTAATTAATGTATTTCTTGCAATAACGGTTTTATTCTTTAAGGAAATCAATGTATAGAAGCTACTTGTCATTCAAGTTGTCAAACATGCTCAGGACCTAATGCCAATTAGTGCACTTCTTGTCCATCTGGAACATATTTAGACTCAAGTAAGACTTGTCAACCTTGCTAGGCTCCATGTGAAAGCTGTTTCAATTCAGCAACTGAATGCACAACTTGTGTTAAGGATTATGAAATTGATAAAGCAAGTGGGTAATGTATTTTTAGCAAGGTTTGTGATATTTCTTGTCAAGATTGTTATGTGTTTAGAGATCCTAGAGGGTGTCTTACATGCAAAGATGGCTATTTCTATAATGGAAGTGAAGGAAGTTGCTAAAAATGTGATGAATCTTGCTCTAAATGTACTTATAGAAAAGATAAATGTATAGAATGTTCAAGTGGATATGAGTACGATGGTTATAATTAAAGATGTTACTAACTCTGCCATGAAAGTTGCGAATCTTGTACAGCTCCTTAGAATCCCAAAGCATGTAAAAGCTGTGCATATAACCATGTTATGTAGAATAATTTATGTGTTCCTTGTGACATAAATTGTATTGGCTGTAGAGATGAACCTACAAAATGTATCGAATGCGTAGCAGGTTATAAGTTTGATCATTCTTAGTAAACTTGTGTTAGTGTTTGTAACCCAGGTGAGTACTAAGATACAGATGGTAGCTGCTAAAAGTGTGTATCTCCTTGCGCCACTTGCTAGTATTAGAGTGATTTCTGTTATAGCTGTATTTCTGGCTATACTTATAATGCTCAAATCAATTATTGTATTCCAAATACAAATTCTTGTCATGAAAGTTGTAATTAATGCAGCTAAAATAATGATCCTAATTCATGTACTTCCTGTAGAGATGGAATGTATTTATCATCTGGAAAATGTTAGTATTGCAGCAATAAGTGTTAAACCTGCGAATTTGGTCCTAATAAATGCACTTCTTGCTAAAGCAATGAATTTTTATTAAACAACCAGTGCCAATAATGCCATAATAGTTGCTTAACTTGCTCGGGAAAAGCAACAAATTGTACTTCTTGTTAAGATGGCTTATTAAAAGATCCAAAAACTGGAATCTGTATTATGAATACACCTATTTGTAGAAGTAATGAATATTTGGATAGTAAAAACTAATGTTAGAAATGTCTTTCTCCTTGTGCTTCTTGTTCCAATTAACCTTACATGTGTTCAAGTTGTATTTCAGGCTATAAATTAAATAGTTAAACACTTTAATGTGAATAGGATATAATTACTTGTAAAGATGGGTAATTCTTAGATTAAAACAATAAATGCAAGCCTTGTCATTCTTTTTGCAACACCTGCGAGTAATAAAGTGATAGATGTACCAGTTGTAGACCTGGTCTTCTCCTTATATAATCCTTTTGCTATGATGAAGTATGCTAAGATGGGTATTTCAAGAACTAATAAGGTAAATGTTAAAGATGTAGTGAATCTTGCTCTAAATGTGTAAACTACTAAGATTAATGTACTGAATGTGCTAATGAATACACTTTAGACTCTAGGACATAAAGATGTATTAAAAACTCAAGCAATTAGAAATGCCATCCTAATTGTAAGGAATGTAGCTAACCAAACAATGCCCTTGCTTGTTATTCCTGCAAAGATGGTCTATTCTTAAATAACAGAAGAGAATGTGTTCAATGTGATAATTCTTGTTTGACATGTGATAGATATTAAGATTTTTGTACTTCTTGCTAATAAGGATATAAGTTAGATGCTACAGGTGGTAAATGTACTCCTGATTGTAAATCAAATGAATATTTGGATAGTAAAAACTAATGTTAGAAATGTCTTTCTCCTTGTGCTTCTTGTTCCAATTAACCTAATATGTGTTTAACTTGTATTTCCGGCTATAAATTAAATAGTTAAACACGTTAATGTGAATAAGATATAATTACTTGTAGAGATGGGTAATTCTTAGATTAAAACAATAAATGCAAGCCTTGTCATTCTTTTTGCAACACCTGCGAGTAATAAAGTGATAGATGTACCAGTTGTAGACCTGGTTTTCTCCTTATATAATCCTTTTGCTATGATGAAGTATGCTAAGATGGGTATTTCAAGAACTAATAAGGTAAATGTTAAAGATGTAGTGAATCTTGCTCTAAATGTGTAAACTACTAAGATTAATGTACTGAATGTGCTAATGAATACACTTTAGACTCTAGGACATAAAGATGTATTAAAAACTCAAGCAATTAGAAATGCCATCCTAATTGTAAGGAATGTAGCTAACCAAACAATGCCCTTGCTTGTTATTCCTGCAAAGATGGTCTATTCTTAAATAACAGAAGAGAATGCGTTCAATGCGATAATTCTTGTTTGACATGTGATAGATATTAAGATTTTTGTACTTCTTGCTAATAAGGATATAAGTTAGATGCTAAAGATGGTAAATGTACTCCTGATTGTAAATCAAATGAATATTTAGATTTCTATGAAAATAAGTGTAAACCATGTACATCTCCTTGTGGAAGCTGCGAATATTATCCAGATAGATGTACTAGCTGCATTTCAGGATATAAATACGACAACGAAGGGTATAGTTGTGAAATCATTTGTCAACCTGGATAATATGCTGATAGAGATCAAATATGCAAACCTTGTTCATCTCCATGTGCAACTTGTGAATACTATGATAATAGATGTTTGAGTTGTGTTTCTGGTTATACTTACACCAACTACAATTGTTAATAAACTTCAAGGCCTAGTATGAGAGGTTGTCATGAATCTTGTAATACATGCACAAGAGCTATGGATCCTCGTTCATGTGACTCTTGTAGAGAAGGATATGTACTAATGAGTGGATCTTGCCAAAAAAAGAAAGGAAATTATTCTAACCCTAAAAATTGA