TTHERM_00547920

Length: 2010 bp

cDNA Sequence

AAAGATATTGATAAAATTCCTATTCTTAATACTAATTAAAGAAAAATGAATATGATATTTATTCCAGGTACTCTACTCTAGAGCAAGAATAACACATACAGGATAATTAAAACTTTAGGTAAAGGACAGTATGGCACAGTCTATCTAGCTATAGATTCGAATTAATAGCAGTAATTTGCTGTTAAATAGATTTTTAGTTAATCTTTAATAAATAAGAAACTCAATGAATTACTCAATTAGGAATTAACTATCTAAAAGATTATTAAAAGCTAGCATACAGTATAAGTTATAGAAGACTTTTTTGATCAGAATTTTAAAACTCATATAATCATACAAGAATACTGCGATGGAGGTGATTTAGAATAGTATGTAAAAAAATATAAGTACCTTCCTGAAGCTTAAGCGATCTCATACTTAAAATAATTACTTCAAGCTTTTAAGGAATTACATTTCCATAAATGTATGCACAGAGATATCAAGCCCAGTAACATACTTATCTCCTAAGGATTGATAAAGCTTGGAGATTTTGGATTTGCAAAATAATTGAATGATTAAGATATAACTAAAACTGCTTTAGGAACAACTATTACTATGGCACCAGAAGTATTTTACTAACAAGAGTATAGTTACGAAGCTGATATGTTTAGTTTAGGCATTGTATTTTATTATATGCTATTTGGGCAGTATCCATTTAAACCTCAAGGTTTGAATCCTGAGACACTCTTTTTGTAAATAAAAGAATAAAACATTAATTTTAACTTAAATGGAGTAACAATAAGTAGAAATACTCAAGATTTAATAAAATAAATGACAGCATATGATAGAAAATAAAGAATAACATGGCTAGGAATATACTAACATCCAGCATTGCAAGAGTAATCCAGATTCCCTCAAGAAGTTATGAGATATGGTATGGTATAAACTGATAACGTTTTTAATAGAGGAATTAATGAAGAGTTTTATTAATAAAATGGTTAAGCCCTATATCAGCAAGTTTTCAAAAACCAAAATGATGCTCTTGCTTATTAATTCATCTAAATAAAATTTGAAATTTAAGATAATTTACCAAACCAGCCTAATAAGCCTTTTAACTAGCAAAATATTAACTTTGTAGAAGAATAAAACAAGAAGAAACTTCAATAGTAAGCAGAATAACAAGAGAAAGAAAAAAAAATGATCTTATAGCAAAATGAATAAGAATTAGAAAAATAGAAAATGATCTTATAGCAAAATGAATAAGAATTAGAAAAATAGAAAATGATCTAATAATAAAAAGAATAAGAAGAATTAAAATAAAAAATTTTATAATAGCAAATGCAAGAAGAATAAAATAAGTTGTAGCAGCTCATTTAGCAAAAAAATCAAGACTTTGAATTAGGATTGCAGAAATATTTCCACAAAAGAAATACAAATTGCATACTGATTTAGATGCTTAACTCAATCAGAAATCTAAAAGATTTTAAAATTAATTATTAAATTCCTGCGTTTTTGACTTGCAAAAAGCTAATAAAATTGATTAAGGAGTATGGTTAGACTTTGTTAAATAAAAATAATATTTTTGGAATGGTTTATTTTAAAGAATTTGTATAATCAAAATAATATTAAGATCTAATTTAAATGTCGAACAATGATTTAGAGAAAGTTAGGCTAGAATATCCTTAAATCTTATAAGAATGCAAAGACAATATTAATAAATTAAGAATGAATAATGCATAACTCTTATCGCACTTGACATCAGAAGAATGTAATGATAAATTTGAACTTTAGTACAAGGAGTGTTTAATCAATTATTCTCTTTCACTTAGAGAACTAAAAACTTCTGAAGAAACTGAAAAGTAAAGAAATCTCTTTCATCATATTATTCTTATTTCTGATATAGCAAAGATAGATACATTTTAAAAAAATAACTTTAATTTCGACTTTGAAAGATACAAAAAAGAAGTTTACAATACGCCATTCAATGAAATGGAGTCAAAGCTTGATGAAGCTTGCTTAAAAATATTTTCTTGA