TTHERM_00548300

Length: 1590 bp

cDNA Sequence

ATGAATTTTAAAAAGTAGCAAAAGGATTAGTTGATATTTAGTTCAGAAGATAGTTTGAATTCAAACAATTCATTTGCCTCTTCTGTTGAAGATAATGATTAGGAAGATTTTAATAACAATTTTATGAATCTGAAGGATTAAATGGATCACTTTTTCTCCCAAAACCCTCAATTATAAGATGCTATTAAATTTGAACCTTTTAAAGAACCTAATTCAGATGAAGAGGACTAAAATTTAAATTAGGGTATTGATTAGTAATAAAATCATCATAAGCCCACAGGTTTTGATCCATATGGAAATCTTAAAAAATCACCAAAAAAAGACAAACAAAGCTCATTAATAGAGCATAGAAATTTAGAAGAAGTTGATAGGAAAAAAAAAATAGCACTAGATTCGGACAACAACAGTGAATCTGAAAGTCCTAAAAAGAATAGAGAGGTTAAGTTTAATTTAGAAAATTAAAAAAAAGAAAAGTCGAAGTTGTGGACATCTATGACTAAAGATATAATCAGAATGGGCTAATTCGGTTGTAAAACACCAACACTTGAAACTGTTAATCATCGTCTAAATATTTTCAAAAGCAAGATAGAAAAAATTGATTATTTGGAATATTTGTAAAAGGAAATGACTTAAACAGCAGGTGGCCTACTTTCTTAGTAGTAAGCTGGTCAAACGGCTAATGGATAAAATCTTTAATACAGTACAAATCAAAATGCAGCTGCCTCTTCATAAACCAATAACAATGGTAAGTTCGTTTTTAAAAAGTTTAATCTAAAACTAATTAAATAATATCAAGGAGACCAAGCAGATGAAGATGGGAATTTAGCAAATAAACAATCAGAGTAAGAAGAAGATGATGAGAATATTGGAAGAGATTCTGAAGGAAATATTATTTATTTTAGTTTTAAAAAGCGTATGTAGATGGAATTAAGATAAAAAGTTGAAAAATCTCGTAAAATTTAGGAAGAAGAATAAAGACTAAAAAGCAGTGAGATCAAGCAACGTTCTGGAGATAGAAGAGTTAATCTGACCGGAAGAGGAGTTTCTGATGCTTTAAAGTTGATAAAACAATAGCAACTTATAGAGAAAAAAAAGAGAGCTAATTCAGAAGATGAGTTTAGGAACAAAAGAAAAAGTTTCACAGGCCTTAAATCTGAGAAATCTATGGAAAATGAAGAAAAAAAATTGCAATTTGCTGATAAAGATTAAAACCTAAATTTCTAAACAAGAATTGGTATTGCTCTATATTAAACTTATCAGTAATGTGCTGGAGATAAGGAATCGTTTAAGAAAACAGCTAACTTTATCTTGAAGGATTATAATAAAACTAAGGCATCCTTTTTTAAGAAGAAACCATTTCCTCCTCAAACAACAAAATTCACAAACGAAGAAACTAAAAGTTTAAATGTTTATCTGCCAGATTTCTCTTCTAATTTATATGCACCAAATAAAAACAATCTGTTCGCTAATATAGATGCTTTTGAACTTCCTCCTGGAACTCCCGAAGGTGATTTCATCTAAATTGTTGATAAAATTCTAGATGGAGCTGTTCTTCGTTTTTGGAAAGAGTCATAAAACTAACAAGATTGA