TTHERM_00548310

Length: 930 bp

cDNA Sequence

ATGAAAAGATACATTCTCAAACTTATAGATGGTAAAGATTCAACTACCATTCAAAAATGGAAGCTTAAGAAGGACAATACTTACATTATTGGAAGAAGTGATAAGGTAGAAATCCCAATTTAGCAAGAATCTATTTCAAGAAAGCACGCCGAAATCTGCGTTTTAGAAAATAGTGCTACAATTAAAGACTTAGGATCTGCAAACGGTACATTCATAGATGATAAGATAGCAAAACATAATTAAATAATATTCCTTAAAAATGGCACTAAAATTTATTTAGGAGACTCTCCTAATTACTTGATTGTCAAAGAAAAAGAAAGAAAAGCCAAGGTTTCTGAACAATCTTTATAGGAATAAGCCGAAGAATAAGAAGAAGTTGAAGAATAATAAACAAAGGAACAAAAAAAATTGAAAAAGAAAAAAGAATCTAAATAAAAAGAAAGCGATGAGGATGATGAGTAAGAGATTGAATAAAAAAAAGAATAAAAAAAGAAGAAAAGCAGTAAAGAATAATAAGAAGATAGAGAACGTTCTCGTTCTTATGAAAAAGAAAAGTAAAAAAGTAGTAAAAATGAATAAAAAGAACCTTAGACACAAGAATAAAAACCCAACACTTCAGTTAGCAAAGACCTCAATGCATCAGATAAGAGAAAACTCTTATGGCAAAACAAGAAAACTGATAATTTAGAAAGTAAAGCTTAAATATATGGAAAAGTAGAAGCTAATGCAGAAGAGACCAATAAATTTTTTAAGTTGCTCGGATTCAAATCTAGCGCTGATGGAAAGTCTTCAACAGGAGCTAAAGTTCAAAACTATTTTATTACAAAGAGTGGTTCTGATAAATAGACCATGATTAATGATTTAGAAAGTTAATATAATGAAGGTATGAAGAGAAAAAATGGTAACAAGGGAGGTTTAGGTTATAATTGA