TTHERM_00549620

Length: 1278 bp

cDNA Sequence

ATGAGCAATCAAAAAGAATAATCAGAAAAAAATCGCCTTAGCAACGAATCATAAAACCTGAATGATCTTGATATAAAACACCTTACAAATACAAGACAAAAAGTTTAAAATAGGAAGAATGTAATGGAATTAAAAAATCAGATGAGTCCTGTTTACTTCAATAGAGATGCGGAAAGATTTAGCTACTTAGATTATTAAGATCCGTTAACAGGCAACTAGATTTATTAATACAATAAAAATAATGTTTTACAATAGTATCAATATAATAACCATTATCCACAATAAATGATAAATTAGGAATAATATGCTTATGCTAATAAGTATCATCATCATTCATAATCTCCTACACCTCATCTTTATAATAATAATAATTACAACAATTTTAATGCTTATACAAGAAAGGATATTTCAGCAATCAACGAATATATAAAATAAAACTAACACTTTAAATCTGAAAATTCTAGCTTAAGCTCTATTTTACCAGACAATAAATGCTCTTTTTTGTCTGATTAATCAGAATATATTACAGAAAGGAGAGAAGATTCCTTTGGTAATGTAGAGATTGTAAGGAGAAAAATTGAATAACCTCAAAATAAAGGAGTTAATAATCTACAAGCTCCTAATCTTCCTCAGCCTCCTAGCGTATCTGATCCTGATCTATAGAAGTACACTCGTAATAACTTAAATTAACCAATCAGTACTGCTTATTAAGTTAATGATAATAGATCATAAGCTAGACTAATTCCAAAAATTAACTTTGCTACAATTATATTTTTGATTCTTCTTATATACGTTGCCTATAAAAATATCAATAAATTCTTAAATGGTGAAAGTATTTTTAATTAATTGACAGCTTCTTTTAAAAATTTTGGGTTAGAATACAATAAGAAGCCTTCTTAAACTAAAAATAAAATAAATAATGAAAATCTGTACTAGTAAAACTCTTTCGATAGCAATAACGATAGTAACATGGATAACTCAAAAACTAATATATATATAAAAGAAGAAATTAAATAAGATATGGATTCCAATTTAGCGAAAAAGTTTGCTAAAGAATTGGTAATAGAATTAGCAGATTTATTAAAAGTAAAAGGAAAATTGTATCGATCTGAGTATGAAGAAAATCTAAGCAAGAGATTTATGAACACTATGCTAAGAGAAATTCTACCAGAAATAAATAAATTACTATTAAATTCAAAGCATATTAGAATTTAATATGATGTTATTAACAGACAAGATTATTTTGAGCTATTTCCTTAAAATTTCAATAATTAATGA