TTHERM_00551090

Length: 1188 bp

cDNA Sequence

ATGTCAGTAAGTTAAGGTGCAGGATTGAAGGCATTTTATCTTTCTAAGATTGAAGAGCTCTCTTTGAAAGTTAATGAAAAGTCATAGAATATAAAACGTTTGGAGGCTTAAAGAAACGAATATAATAATCAAGTTCGTATGCTCAAAGAAGAATTTTACTCTTTATAATCACCTCACTCTTATGTTGGTGAAGTTGTTAAGCCAATGGGAAAGAGCAAAGTTTTAGTTAAGATATCTCCTGATGGCAAATATGTAGTTAATATAGATAAAAGCATTAAAATTGAAGATTGTTTACCAAATACTCGTGTTGCTTTAAAAGGTGACTCTTATGTTCTTCACAAGCTTCTTCCCACTAAGGTTGATCCTTTGGTTTCTCTCATGAAAGTCGAAAAGGTACCCGATTCTACTTATGATATGATCGGTGGTCTTGATCAATAAGTTAAGGAAGTAAAGGAAGTTATTGAATTGCCAATTAAGCATCCTGAAATTTTTGAGTCTCTTGGTATTGCTTAACCTAAGGGTGTTCTCCTTTACGGACCTCCTGGTACTGGTAAAACCCTTCTCGCCAGAGCTATTGCACATCATACAGATTGTACTTTTATTAGAGTTTCTGGTAGTGAATTGGTTTAGAAATATATTGGTGAAGGAGCAAGAATGGTCAGAGAATTATTCGTCATGGCTAGATAACATGCTCCTTGTTTGATTTTTATTGATGAAGTCGATTCTATCGGTGGTGCAAGAATTGATAGTGATAGAGGTGGTGACTCAGAAGTACAAAGAACTATGCTTGAACTTCTTAACTAACTTGACGGTTTTGAATCTACAAATAACATTAAAATTATCATGGCTACTAATCGTATTGATATATTAGATCCTGCTCTTCTTAGACCAGGTCGTATCGATAGAAAGGTAGAGTTCCCTAATCCTAGTGTTGAGGCTAGATTAGAAATCTTATCAATCCACTCAAAGAAAATGAATCTCATGAGAGGTATTAATTTAAAGGCTATAGCTGAAAAGATGGGAGGAGCTTCTGGTGCAGAATCAAAGGCTGTATGTACTGAAGCTGGTATGTTTGCATTAAGAGAAAGAAGAATTCATGTTACTCAAGAAGATTTCGAAATGGCTGTTTCAAAGGTTATGAAAAAGGACTTAGAAAAAAATATGGCTCTTCGTAAATTATGGACATGA