TTHERM_00554630

Length: 1944 bp

cDNA Sequence

ATGTTGTACAGAAAATACATGTTGAATCCAGCCTAAGTTTCTGGGTATGAGGGAATGTTTGGAATAATTTTTGCGCTTATTGGATGTTTAATTGGCACTTATTTTTAAAATGATTATATTTAAGAAGATTTTTATTAATTTGTGAGTTAAGTCTTCTCATTCAAAAACCCTGCTATATTCTTTTTAGTTTTGGTAGTAGTTTTAATAAATATTTTTTCAAGCTGTGTTAATTAGATCATCATAAAATAGATGTCTGCACTAACCAGAGCCATTTCAGACTCTAATTCTTTTATTTTAGGATGGTTACTCTTTATGATGGCTGGTTATTATTCATTTGGATGGTAATATCTATTAGGTTATGTCATTTCTATATTAGGTATAATCATATTTTGTGAAATCTTAGTTCTACCATGGTTTGGATTCAATAAGAATCGAGGACATGATTTTGTAGCTCCTAAATTAAATTATTATTATTCTCAAGAAGCATATCCTTATTACTATTAAGCAAACATTCCCATTCAATAATAATAAAATTATAATGGATATAATAACTAAGTGATTAATTTGGAAAATAACCAATAAAATCAATTCTTAAATCAACCTTTATTAGCAGAGATAAATTTAGCACCTAACCAATAGTTATAAAGACCTTCAAATATTTCTAACTAAGATTATTATAGCCAAAATAGACAATAAACCCTACATTAAAATCTAATTGATTAGCCAAATAACTTTAGTTAAAATTAGTTGAATTTTTAAACCACAAAGGAAGTATTAAAGGAAATATTATCTATGTAATTTGAAAATTTGACATAAATTAAATAAATAATTGTATTAATTCAGGATATTCAAGCCAAAACTCCTTAATAAGACCATAGCACCAAAAATGAAATAGCTAAAATTTTGAAAAAAATTGCAAGTTAATTGACAAATGACTACTTAAATACCATAAAAATGAGAATGTTAAAATTGGTCTAAGAAGATTAGTATGCGAATGTTTATAAAATAAATGAAATGAGATATATTTCAGAAAGATTATCTTTCTTAGTTGATAATAATAATAGTAATATAACAATAAAATCCATAAACGAAATAATAGCATGGATTGAGGATAATCATTAGCCCACTGAATTTACACAAACTCTCTAAAACATTTAAGCAATAAACTAGCTATTTTTGAGTGAATACTAGAGAAATTAGGAATCTGGATTGAATTGGAAAGATTAATATGAAGCAATCTAATAAAAATTGAAATTTAATAATAGTCAAGGATAGTAATTTGAACAGTCAAATATTTCTAACTCAAATACTTTAAACCAAAGCGGACAACAAAAATTAGATTAAAATTTAATGAATTAACCTTACTAGCTTAATTAAAATGAACAATATTTAAATACAACAAAAGAAGTATTAAAAGAAATTTTATCGACAGAATTTGAAAACTTGACATAAGTTAAACAAATCATTGTTTTAATTGATTATATCAATTCAAAAATTAATTAAAATGATCATAGTCACAAATCAGAAATAGGCAAAATATCTCATAAAATTGCTTCTGTGTTGATAAAAAACTATTCAAATATCATCAAAATAAAAATTGTAAAATTAATTTTGGAAGATTAATTTATGAATATTTCTAAAATAAATGAAATGAGGTATATTTAAGACAGACTATATTTCCTAGTTATCAACAGTAATATTAATACTAAATGTCTTAACGAAATTATCATCTGGATTGAGAACAATCTTTAACCTAATGGATTAACATAAGTAACTGAAAATTTGTAACAAATTAATGAATAATTTTTAAATGAATAAAAGAGAGATTTTTAGTAATCTGTCTCAAATTGGAATGAATAATACCAAGCAATATTCATTGAATAAAAGAGACAAATCAAGAAATAACAGCCTAATGAAGATCAGAAGAAGTTGATAGAAATATGA