TTHERM_00559750

Length: 2037 bp

cDNA Sequence

ATGGAGAACCAATAGTAATAAACAGAATTGAAAGAGACTCAAGTATTGAAGGAAATTTAAGCAGATACTTAGTAAAAATCAGAAATTAAGACTGAAAAGTTAGAAGCTCAAAATTAGCAATTGTCTGAGTCTGAAAGTAAATCAGAAGATCATTCTGTTTTACTTAGCAAAAGTCACCAATATTTAAATAGAAGAGTTGAGTGCCAAAGTTTCTATGGAACAATTAAATACAGCGGACCTCTTTTACATGAAGGAAGACCTGCAAATAGCGAAAATTAACTATGGTTTGGAGTAGAATGGGATGATGAAACTAGAGGAAGACATAATGGAACTGTAAAAGGAACTTAATATTTTTAAACAAAAGATGATAAAAACTCAGGAACTCTAGTAAAATATGAAAAAGTTAGCATTGGTATTGATATTTTAGATGGTATATTAGCTAAATACTTTAAAGAAAATATTCCTTAAAACCTCAAATAGCAAATACAAGATTAAGTTGATAGAAAGTATAAAAAGCAGGTGCTAAAAACTGAAGTTGAGAACCTTCCGGACTCAGTATAATAAGAAATAAATTCTGAGAAGCTGAAAGAGGAGGAAGAGTAAAAGCGTGGTGAAGAATAAATTAAGAAAGTAATTTAAGTAGAAATGGATGAGGAAGCCTATTTTGAAACATTTAAGAAGCATAAAAAGATGGTACAATTTTACGGCTTTGATAAGATTTGGAATAGACTTAATAATATAACTGAGTTGACTGAGATGTCTTTGTAGGAAGTATGCATTTCTGATTTAGGTCATTCAAATTACTTGAGAAGATTGCTTCCAAATTTAAAAACACTCTCTTTGGAAAAGAATTTGCTTTTTGACTGGGATTAGGTTTTCTAAATAGGCTACGAATTAGAATAATTAGAGAGTCTTTCTATCACTAGTAACAAGCTCATGCCATTAGAGAGAAATGTTTCAGAAAGATATTCTAAAGATGTAGAGGAAAATACTCTTATGTGCTGGAGTAATTATACAAGGATTAAAGATGTTACTCCTATGGGAGTATTCCATTCACTCAAAACACTTATCGTAATTGATTGCAATTTAAATTGGACATAAGTAAGTCGTTTCTTGCCTGCTTTCCCAGCTCTAGAAGAGTTGTTTTTATGCAGAAATAATATGACAGATTTTGAAAATTTTACTTACAGAGATGAAGACTTAAAAAATTTAACTTTGCTTAATTTAGAAAACACAGAATTGGATAACATTGAGGGACTTAAAGTTCATTTAAATAAACTTTCTAAGCTCTAAAAACTCATTCTTAACAAGAACAAGTTAACTTAATTGGGTAATCTTGAAGTCTATGAAAGCATCACTCACATATCTTTAGAGTCTAACCTGATTGAAGATCCAATTATTTTTACCTAGCTATCTAAATTTCCCAACCTAACTTATTTAAATATTAAGCATAATCCTATTGGTGATAAGTGTGGAAAATCTTATGTCCGCCAAAGAGCTGTTGCAGAATGCCCAAATCTCAATATAATTAATGGTTCAAATCTAAAGAAATACGAAAGAAAGGACTGTGAAATTTTCTACTTGAGAAGAACTTTTGATGACTATTTTAACCTAACTGGATAAGTTTATTACAAGTATAATCTTTAGTAATTCCTTGAATGGGCTGCTAAGGAGCATCCAAACCACGGTAAACTATTACATAAGTATGGTAACCCTTACGAGTAATAGCCAGAAGAACCTAAAAATATTACAGAAGACTCAGCCCCTAAAAATGTCATGGTTTAGTTAAATCTTATAGCTGCAGCAGGACCTCAACTAGGAAAACCTAATAAAAGCAAAAAATTCCCTGATAACACATCCATTTTAAGCTTAAAAAATGTTTTAAGCAAGTTATACGGTATTCCAAACGACAAGCTAATTTTAAAATACAGAGTTAACTAGCATGATCCAAATGAAATCTTAGATGAAGATCATAAAACTTTAGGTTTCTATGGAATTAAAGATAATTCAACTCTAATAGTCGATTAATTAGATTGA