TTHERM_00564060

Length: 2184 bp

cDNA Sequence

ATGAAAATAAAATCTAATATTTCTGAAGAATTCCTAGTCAATGCATTATTTGAATCAACTGAGATTATTAAAAAACTTAAAATGTTTAGATACGTTAAAAAGAGAAAAATTTCAAGATTGCTTTTTAAAAAATATTAAAAGGAATACTCAAAGGAAGAAAAGGCTGAACGTCAAAAAATTAAAAATCGTGAAAGTGCTTAGCTCTCTCGTGACAGAAAGAAATTGTTAGAAAATTAAATGCAATAAGATTTAAAGTTTTTAACTGATGAAAACAAGCAGCTCTAGTCCATGATAAATTAACACTACACATGCTAACAATGTGGCTTCTTTAATAATCCTTCATCTAACACAGCAACAACCAATACTACCACTGATAACAACACTAAATAACAATATTAAAACTGTAAAGCAAATCACATTCAACTTACTACCGACTCAATACAATAAAGATACTAACAAGGAATTTAAAATATCGATTAAGCTAACTAATAAGGAACCGATAATAACCCCAACTCTTCAGGAGCTGTATACTAATTTTTTGATTTTTCCAGGACTAGTGCTCCTATTATGGCAGCTTCTCCTATTAATTTGTGCAGCTTTGGAAAAGGTGCATGGAGTACAGCCTTTGTCATATTTATTATATACATGATGCTTGTCTTTTCTGGATCCCAATAAGATGGCAATGGAACTTTAGGTTCAAACTTCCGTAACTTATAGTTCGTAGGGCCAAACGCTTAATTATTTGAACAATACAAAAACTTAACCCAAGAAGAACTCTTAGAAGAACTGCTGAAATAAATACAGCTGCTCAAAGAGTAAGAGAAAGATGAGCAACTTAAGTAACTTAAACTTATTCAAATGCTTGCTAATGCTGCTGTCACTCTAAATCATACTCCTGGAACTGAAGAACCTACTTCAACTCCTGAATTAAATGAATTATAAAAGTCTAATTTAGAAGAGAGCGAAAAGGATTTCATCATTGAGGAATCTCAATCCTAGACTTCCTCTTCCTCTACCGCTGCTAATAGTGCTTTGTTGGAAAAGATTTAAGCCTTAGAGAAAGAAGTTGCAGCAGACTCCGAACCACCTATACAACAATCATTCTTGGATTTCTGCTAAAAATATAAAGAAATTCAATCAAATAACGAAGAAGAAAGGAGCTATTATAAAGATTTAAGCAAAAAGCTTGATGAATTATAAAGGGAAAAGCTAATGCAGCTCGAAAGCTTAAAATCTATTTATTGTGTCAGTTCTTCTGATACTCCTTTTTAGGGAAGTAATCAAGCCGCTACTGCACAAAAGAATACTTATGAAAACTAAATGTACAATCCTAAAATGTAGTTCCCTACTCCTTTCTTCTCTGAAAAGCAACTCAATAGCAATTATTTGAATCCTTCAGTTTTGTAAGAATAGAGCTTAGATAAATTAAGAAATACAACTACTGAATAATAGAATAACAACAGATAAAATGCCTATCATAACAGTCCACCAACCTTCGATAACATCAGCTAATTCTTTAATGACACTGCTAGTTTTAGAGAAGAGGGTATTGACTCGTCATTGGATTCTTCATAGAGCCTTGATGCTGTCAATAACAGATAGGAATAGTAATTCTTGTAAGAATAATAATAATATCAATAATACAGATCATAAGTGAGATAGAATAATATGTAATAGTAATATTATAATAATTAAAATATTGAATAGTTTGAGGAAAATCACGAAAATATTAATATGATTGGTGAGGAAGAAGATCCTTTTAATGTGGCCCCCCAAATTAATACCAAAAAACCAAGTATTAATTATTATGAGTTGATGTAAAAGAAGAGTGTTGATATTAATAACTAATAAAACTAACATCAGGCATAACAACAATAATATCAATAATTTAACCCCCAAAATTAAGCATATGCAACTCAATAAATTGCTTGTTAATATTCATTCCAACAGAATAACTTTGCTGAGGATTTCCAAAACTCCAACTCTACCAACTCTATTAATTTATAGAGTGTTTAAAATGGAAAAATTTAACAATTTAACTTACTTTTCTCCCCATAATACAATTCTGGCAGCGGTATTAATAATAAGGATGATGCGCACTTATTACATAATGATGTTGAAAAGTATATTAAATTCTAATGTAAATTCGTAGATAGTAATTGTATTTAAAAAGATAATTACTGA