TTHERM_00566830

Length: 5124 bp

cDNA Sequence

ATGATGATTCATTCAACAGAAGGTGTGAATTCAAATAAAAATTAAAAGGCTATTTTAAGAAAGGGTCATAATCATCCAAATTTATTGAATTAAAGAAATTTATCAGAGTAGAGGAATATTTAATATAAGCCTACATAGCAGCAACATAATGGCTTATTGTTAGAGCATAATATTAGTCAACAAGAAAATATATAATTTAATGTAAATAGAATCCAATAGGGTTCTTCATGTTAGATTTAGTATTTCTTTCCTAAATCAGTTAAAAGAGGAGCAAGAAATAGAACTCCTGGCAATGAAAGTAAAAGTGGATTTTCAATAAATAGCTTGAATGACAATGAATAATAAAACATATTAATTCATGCTAAAAGCGGCGATTGTGATTTTAAAACTACCTAAGCTTAATTCTGCGAAGTTGATATAAATTTGTTGCAAAAGAGAGATATATCAAGGAAACCAGTTTCAAATAGTGTTGCTCAATCTCTGGCTACAAAAAATGTGAATGATTTAATGAATCAACAAAAAAGGTCTTCATCATCAAAAGCAATTTCATCTAATAATACAAATAATTTAATATCTACTCAAGTTATTCTTTAAGAGAGTTAAAATAGTAGATAGTAGATGTCATCTGCTTAAAAAGGATAATCAAGAACTCCTAAAAATAATAAAACAAAATTAAATTCTTAATTAACACCATCTCTTGAAAGAAAGAAGAATTCAAATTCAGTGATTTCAAATAAACGATCAACTTCAATTAACAAGCAAGTAGCTTAATAGCCTAGCTAAGGATCCTAAAAAAAGTTATCCAGTAACAAAGTAAACAACCCTAGCTTAGATTAGCTTCAAAATCTTCCTTATAAAAAAATAGAAAATCGTAATTTAGTTATTTATATAGCTTTAAATAAAGTTATGTCCATTTAATTTAATATTAGTGAGTCTATACGCTACAGGATTAAGACTGTTGGTAACGAAGAAGATGATTCAGATGAGGGATTCAATCCTGAAATTATTAATTTAAATAATTTAGAAGATAATGACACACCATTGAGTAAATTTAAAGATGTTATTCTCTCTAACTAAAAATAACAACCAAGCGATTTATTGAATCCTCCAAGACTTCAAAATTAATAGTACCCTCCAAAAATAAAATTTCAAAGAGATGTAGGCAGAGTTCAAGGAAACATCTAGGAGTGCACTGTACTAAAAAATTTCCTAAATTAGGGTGAACATAAGCTACAATAGTAAAAAGGAAATAGTAATTAAAGTATTTAGCTAAAATAAAAAGATGCAACAGATAAATCTCCAAATGCCAAATTAATTAACTCTAAATAAGTAAATATGAGTGGAAATTAGCTTGTAAAAACTGAAAATTAAGGAGTGGAAGTAAATCGAATTAGAGCTATTTCTTCAAACGGTGTAAGAAAAAGAATTTTGACAAAAAGCAATGAAAAGCTAAGAACAAATTTGCATATAAATACAGACAATTATTGTGAAATCGATTTACCTCAATAAAGTTTATATTAAGCTGGTGGAGCAGCCACTACAACTCTAGATTCCAAAGGGTCGACAAAGCATACAAATACTATTAAATTTTCAAGTAGAATAGACACACAAAGTCTGTTCAACAACAATAAAGCTTAGTTAAATAATAATCCAAAATTGGTAAAAGTTAATTCTTCTAGTGATAAAGGTAATTAAAATAGAGCTTAGAGGATAAAAACTGAAGGAGATGAAGTCTCCTTACCAAATTACTCTCCAAGTAATCCAAAGACATACAATGTCAATAACTATTTACATCTTTCTAACAAACTAGAAGAGGATAGATTATTTAAGCAAGATAATTTTCTTGTTTAGTATTAACCTTAAAGTAATAAATCTCATAATAGTGATGTTCTACTTTTTACATCTCAAAAAAAATCTTCAAATAAATCTAACTAAGATATTAAATATTTAGAAAGCGATTAACAAAAATAATGTGCAACAAATTAAGTATAAGAAAATACAATTTAAAGTGATTAAATAATTTCTCCTTAGTTTTAAAAATTAAGATTTAAAAATACTTAAGCTATAACATATGAGAGAAACTATTCTGCAGATGGAACTAGAAACAAATAAAATTAAGATCTTAATAGCAATTTAAAATAATTAAAGAAAAAAAAATTAATGATAAAAACTATTAATCCATATAAATCAGAAGAGAAAAAGGAAATTTCTTCTTAATCTGAAACCCCATCTAGCGCTCATAGCTCAATTATGTTCAGTAGTATTGGAAACAATAATGGAATATTAACTAAAAATACTGATACTTTCTCTAAAAGTCCTTTGAGTTTAAGGAAATCAGATGGTGTTAATATTGTGAAAAGCCACAATTAGTAAGGAATACTATAATCTCAGTTTAGTAGTGGCTAATAAAATTTTGAAAACCAATAAAATGTGAGAGAAAGCATAGCAAGTGATTATTAATCTAATTAAATTTATCAGAGTGTTTAACATAATTATTCTAGTAAAAAAATGGTTGATTGGATAGAAATAACAAGCCCAAACAACATCCATTTAAGCTCTGATTAAAACTCTAATGCAATTATAGATAATAAGAAACAACAAAAAATCATGCTACGTCCAACAAAAGTTACATCAAACGAAAGAAAAAATAACAATAATAGTAGTAATGGAAGCAGATCACAAATAAAATAATTATGCAACACTAACTCAAATAATAACATACTTTAATCTTCATAAAATATAGCAAATAATCAAATTTTATATAATAGTAATAATTAATAAATTAATTAAAAGGGTTATTTTTCCGTTCCTATGCAGCTAATAGCAGCTCCTTAGCAAAATCTTTACTAGGAAAGTGGTTAGTAGAAAAATTACTTTTCATCCCAAAAATTTACAAACGAATTTCGACTCTCTGTTGAGACATTTCAGCCTTCAGAAAAAAAAGATAAAAATTAATCTACAAACTCTCTTTTATCTTCATCTAACAATAATAATCCCAATTTTAATATAATTTTCAACTCCAATAAATCAAATGATGCTAAGGAACTAAAAACAATAAAATAACAGATAAATTTTTATTCTAATATTGATGAGGATTAATAAAAGCAAAAATAAATTTTAGATTCCATAAAATCTGATGCAATGAAAAGCATATTGAGATAATCCTTAGAAAAAGGAAAAGATTAATCACAATTCTAATCAGATTCTATCTAAGAATTGTAAAAAGACCTCCATGAAATGAAACTAAATGTTTAAATAGAAAATATGAATTAAAATTTTGCTACTTTAAATAAAAACTTGAAGGAAATGAACAATGACTTAAATTTAGAATACTCAAATATCATTCCAAGAGATTCTAGAAGTAATATTTTAGAAAATATAGACAGCTATCATTTTGATAAAATTCCAGAAAATGATAGTAATAATCATTCTAAAAGTATAATTAATTGTCACGTTAGTATTTTAAATAATAACTAGTAGGATTCTTTTAAATACACAAACGAAACAAGCTAAAATGATAATTAACAAGCTGAAAAAATGCAGTAACTAGTTAATAATTTTGATTTTTCTGATATTTAAGAGGGACCTGATGATAAAGATATTATGTCGTAATTAGAAAAAGAAAAAACTGAGTTTGAGTAAAAGCTATTGTAAGAAAAAATAAAATTTGAACAAAGATAGCAGCAATTAAAATAAGAGTTCATTTATTAAAAATAAAAACTGATTTAGTAACAGTAAATGAGACTAAAAAATAGCAATGGGCAAGCTAGCTCAGTAAAAAATTAATTTGAATAAAATTAATCTAAAAACAACAGCTTACAAAATAAAGAAGATAATTTTGCTCTTTCTCCTTTTTCTAGTTAAGAACAACAAGACGTAAAAGAACAAAACCATAACTAGTAAAGATAAAATTTAAATATGAAAAAAAATAACTCTTTTACACAATATCCTAGTAACTGTGGATAAAAAATGTTGTAATTTGCTGATAAAAGCTTAGACTTAAGCTTCACTAAAAATCCGAATTTAGAAAATGATGTTTCAAAGCTATTTAGACAAGAATAGATAAGTCAAATACTTCCTGAGAGTTAATGCTCTTTCCTAAGCGAGGTCGAAAATATATTAGAAACTAATAACAACTCTAATTTATTTACAAATGGAGGAAACTAAGCCATGAAAAATTAAAATATTCATTAAGGTTTTAACTAAGATGGAATAAATGTAATAAACCTATAAAACTAATCTTCAGCAAAAAATATCAGCCAAAGTACTAAGTTCTAAGAAAATCAATCAGCAATATAAAAGTAAAACTTTTTCCCTACTATCAGTCCTCAATCTTCCTCTTAAAGTTTATCAGATAAATAATATAAGCACATGAATTCTAATAATTAACAATTTCCTAATATTCATATAAATGCAAATATGGTTAACATTCCTAAATAATAAAGAAAGAATAATTTTTAAATACATGAATAAATTTAATAATAGCTAGTTATTGAAGAGCAAGATTGTGAGCAATCTTAAGACTCATCAATACAGATATAATACCATCAATAAAACAAAATTGCCAATTTCAATTCATAAAATTCAAATAGAATGCCTCCTCTTCCTCTTAATCGTAGTATTGAGAGTTTTTAGCTAATTTCTGAGAAGAATCTCGTTTTTGCAAAATATAAAATTTTAATTTATTTTGCCATTTAAATTAAATAAGAATCCTTAACTAAATTAAGATTTTGGCTAAACCTCCTTTTAAAATAGATCGCCTTAATTTTGACCAACTATAATTATTAAGTATTAATATCTTCTAAAAATTACACCAAGAAGGCTTAATGTTAATTAACCTTTTTTAATTTTAAAGATTAATGCTTAAATATTAAAGATGAAAGGAAAATTAACTTACCAAACATCATTATAAATAATGCAATCAAAATGAACGAAAAAATAAAATTAAGGTACATTTTATCATCATTCAATTACTCAAACAAAGCAATCCAAAAAATTAAGAGAACATAATTGGCTGATTATGATTCTAATTTGTTTATTTTATCATCTTAATATGGTTTAAAGAGCACTAAAGAAGCACTGTAGATTAACTATACAAATATAACTGAAGTTAGTTAAATTTGA