TTHERM_00568030

Length: 753 bp

cDNA Sequence

ATGAATGAAATATATGAATAAAATGAGAAAGAAGAAGAAGAAAAAAGTATCATTCTTACAATGAGTTCTGCTGTTGAAAAGAAAGATCTCCCTGCTGACTACGGCAAAATGCCCGCTGGATACAATTTCCTCACTAGAGGTAAGGACTGGAGAGAATACGACAAAGATTTTATCTTAAGAACTGATGCAGTTTGGGAAAAGTTTTAATTAGAACACTTCTTCAGAAACTATATGAAGTGTTTCTTCTTTGACCATGGTCTTAAAAAGTATTAAATGTTTGAACCTGAAGATATGTACACTGTTGTCTTTGAAGGATGGGCTTTGGATGATTTGATTACTTTCCCCGGTTTTACTCCTACTGGCAGAACCAACAGCTATCAAATTGGTCTCTCTCCTAGATAAAGAACTGTTGTTCCCACTTAAACTTTCTATCAAATGCAAGATTACTACATGTTGTGCGGTTTGAGATTTGAAAGATGGTTCAGATGTGATTTAGTTTATCATGATCAAAGACATACTAAGTTCGATCAAGTTAAAAATCAAAAGAACTACAAAACTTATCCTTGCTATAGAGAATATTATGAAGCTTAATACGCTTGCTAAGATGATATGTTTGATTTCTTGATGGAATTGGCCTATGCTAGAAGAGCTGCCGATAACTTCGAATCCGATTTTGCCAGTCACGAACTCACCACCTTACCTACTTTCTACGATACCCCTAAGGCTGCCGAAAGAAAAACTTACACTTACTGA