TTHERM_00569290

Length: 2142 bp

cDNA Sequence

ATGTGGGGAAATAGCTACAATAATAATAGTTCTAGTAATGGATACTCAAATAACAAAAGCAACGGATATTCAAGCAGCAATAATAATGGAAACTCCTATGGAACCGGTGGCAAGTGGAATGATAACGGAGTTGGTTAAAATTTGGCTGCAATCGATTGGACAAAAGAAAATCTTACTACATTTTAGAAAGTTTTTTATAAGGAAAGTTAGAAAATAAGAACTGAAGAAGAAATCGAAGAATTTTACCGCCAGAACCACATCTCAGCCAAATCACCTCATGGAAAAGTACCTGACCCTTTTTTAAGCTGGACAGATACTCACTTCCCTTAATATATTATGAATGAAGTTACTCACGCTAAATTTGAAAAACCCTCTCCTATTTAGTCTTTAGCATTCCCTGTAGTCCTTAGTGGTCACGATTTGATTGGTATTGCAGAAACAGGTAGTGGAAAAACTCTTTCCTTCCTTTTACCCTCAATAGTTCATATTAATGCTCAACCAACTGTCAAAAAGGGAGATGGTCCTATCGTCCTCGTTCTTGCTCCTACTAGAGAACTTGCTATGCAAATCGAAAGAGAGTCCGAAAGATTTGGTAAATCCTCTAAGCTTAAATGTGCTTGTATCTATGGTGGTGCTGACAAATACTCCTAAAGAGCACTTCTCCAATAAGGTGTAGATGTAGTTATTGCTACTCCTGGTAGACTTATTGACTTTTTAGAAAGTGAAACTACTACTTTACGTAGAGTTACTTATCTCGTATTAGATGAAGCAGATAGAATGTTAGATATGGGTTTTGAAATTTAAATTAGAAAAATCTTGGGTTAAATTAGACCTGATCGTTAAACATTGATGTTTTCTGCTACCTGGCCTAAGAATGTTTAGAATCTTGCTTAAGATTATTGCAAGAATACTCCCGTTTATGTTCAAATCGGAAAACATGAATTAGCTATTAACGAAAGAATTAAATAAATTGTTTATGTTACAGATCAATCAAAGAAAATCAATCAACTTATCAAGCAATTAGATTGTTTGACTTAGAAAGATAAAGTATTGATTTTCGCTTAAACAAAGAAGGGATGTGAAAGCATGAGTCGTATTTTGAATAAAGAAGGATTTAAGTGTCTTGCTATCCATGGTGACAAAGCCTAAAAAGACAGAGACTATGTTATGAACAAGTTCAAAAGCGGAGAATGCAGAATCCTTATTGCTACAGACGTAGCCAGTAGAGGTTTGGATGTTAAGGATGTCTCCCACGTATTTAATTACGATTTCCCAAAGGTTATGGAAGACTATGTCCATAGAATCGGTAGAACAGGTAGAGCTGGAGCATATGGTTGTGCAGTATCTTTCCTTACTTTTGAAGATGATAAAAAGATATCAAGGGAATATGTCCAAATGCTTCATGACGCTAAGTAAGAAATTCCCATTGATCTTCTTGATCTTGCTAGTATTAATCCCAGATACAGAACTTAATATAAAACTGTTTCCTCTTCATACTATGATATTAAGAAATTTAACAGTGCTGATACTTCAAAGCCTTCAGAAAATCAGAATGTTTCAAATACTGCAAATAGCAGCGACAAGTACACCAGCAGTAGCAGCTACAATTAATATAAAAGCAAAAAAGATGAAGATGACAAGAGAAGTAGAAGTAGAAGTCCATATAAATCTGAAAATAACAACAGATGGGATAAATATAATCGCACAAAAAGCCCAGAATACCGCAGTTCTAATGGATCTTCTCATTATAACAACGTTAACAAGTATTCTTCAAATTCTAATAATAATTCAAGTTCATATTCAAAGAATTAATCCTCCACATCATCATCTTCTTCCTATGGATAGAATAATTAATCATCCAATTTAATGAGTAAACCATCTAGTAAATTCTCTGCTCCTACAAATGGTAGTTACACAAATGGATTTTCTTCAGTCTAATAAAATTCTCAAGTTTAAAATCCATTTATGCCAATCAATCCTTTACCTCAACCTTTTATGTACTAAATTCCTGGATTTAATGGTTTCCCTAATCAAGGTTTCAATAACTTTTACACTGGTATGGTTCCTCCTCCTCCACTCCCTACTGGTGCTCCCTCATAATAATAAAATGGATTTGCTTAAAATACAACAACATCTTCTTGA