TTHERM_00577050

Length: 996 bp

cDNA Sequence

ATGGACGAAGATCTCGAAATCATCTATTTAGATTAAGAAAGTGGTTAATTGGATTCATTAAAATATTATTTTAGCTCTTAATCAATGTATTCATAAAAATAATAAAATACTACATATTTTATTTTACCTTTAGAATAAACTTCAGATTATAATTGCTAAAAATCATGTTAAGCCAATGAAATAGAAAACCAGCTATAAAAGAATAAAGGAGGTAATTGCATAGGAGGGTTCATTCACTGTAACTACAAAGGATAAGCTGAAAAGTTTAAATCTGAAATATTAGAATTGATTAAAAACTCTATTTATTTCAAAATAGGAGAGTTTGAAGAAGGTTTTTCAAATGTTCTAAGTACATTCAAAACAAGATTGTTTTCATTAGACATAATTTACGATACAAGTTATTCTGTTTCTCTAAATAAAGAAAGCAGCAGGATTTAAATTTCATTGAATTTATTTATGAAAATTGAGCAAAAAATTTATTTGTCAAAATCTATAATCCCTTCATTATTAAATAACATATGGGGAATTAAAAACAAAGGTTCAAACAAATATCGAGAAGTTGATTATAAAGTGGATTTTTCAAAGGAAACTCCGAACTATTATTTGTTAAAAGAAAATTCTGTCTTTGATATACAAGAGCTTATATTAATATTAAAAGAAAGAATGAACTTTTCATATATCGCTGGATGTTTAAGCACTGTTCTAGGTATTGGTATAGGTGCTGCAGGAGGTCATAAAAAGGAATGGACCTAAGAGAGAAAAGACTTGTTGACAAAAGCTACATTTTATCATTTTATCTCAAATACTGGAATGATTATAGGGTCATATAATAACCCATTCAACTATTCCACTATTCTTTTTTTGATAGGAGTGACTTGCTTTAGCGGATCTCTTTATTATAAAACATTTACAAACAATGAAGATTTTAAAAGACTTCCCCCATACGGTGGTATGGCTATGATGTTAGGGTGGATCCTTCTTGCATTTAAAAAATGA