TTHERM_00586840

Length: 1794 bp

cDNA Sequence

ATGGAACTAGAATTTGCAAAATAGGATGATGAGAAAGATGAAAAATTAAAAAGCCCTAAAAAAAGTAAACATAAAATAGTTTATGAACAAGAAAAAGAATAAGATAATAATCAATAAATGGATGCTGAAAAAGATATTTAGCAAAATATACTTGAGATCTGCCTATAAATATTTCCATATCCTGAGCCTTATTCAATTTAGATTGAAAGCATGAAAAGTATTATCAAATCTTTGTGTGAGAAAAAAAATCTGCTATTTTAATCTCCGACAGGCACCGGTAAGACTCTAGTAACTATTTGCTCTGCTCTTGCTTATGCTATAATAAATCCTAATGTTTAGGTATTTGTTTTAACTAGAACAAATGAATAAATAAATGGTTTTATTAAAGAAATTAGGAAAATTCGAAATTATGCAGATATTAGTAGATACTCTATCTTAGCTGGAAGAGGTTCATTTTGCTTGAATATAGATAAAATTAAGTCACAAATTTAAATGCTAGGTACCAGAAAATCTAAATACAATAAAAATCTTAGTAAGATTTGCAATTTAATGAAACAAAAATTAAATTGCAATTGTGGAAAGTGCAAAACATCTATAATAGCAGCTTCTAATGATGATATAGATGAACCTTTTAGTATTTTTTAAAGATATAAATAAGTGGATATTAATTAGAGATCTAGTTAAAATAAATAAGATTAAGATTAACAGGAAAAAAACTGTTATATGTGCCCTCATTATAGGATTTACTAATAAATAAAAGAGAAGAAGGAAAAAGAAACTATAAAAATGAATTTACACTTCCCATAAGTTCGCTCAGCTTCTGATTAAGCTTATACTTTGCCTGATATAGAAGATATGAAGAAATTATTTTAGTAAAAAAATTTAGGATGCCCATTTTATTTCAACAAGCTAGCAACATAAAATGCTAAATTAGTTTTTTCTACTTATAATTATGTCATTAAGCAAAATATTCTAGCAAGTATTTAAAATCTTTTTAAAGGTAAAGTTATAGTAATATTTGATGAAGCACATAATGTTTCTGAGCAAGCTGAATAAGAATAAATTATTAAAATGAGTAATAAATATTTTGAATAATTCAATAATACACTTGAAAAGGTTTAAAAAATTTTTTAAAAACCTCAAAGAAATGAGATGCTTCAAGTAGGTTAAGATATTAGAGCATTGATTTAACTAGATATTAAATAGGAATCTCTTTTTTTAAAGGAATAACTTCTTAAAAGAGCTGATAAGTAAAAACAAAATAAAAGTGATATTCAAGATAAAAATGGTGAGGCTGATTATGATAATGATGAAGATGAAGAAAAATTTTTACAAAATTCTTATAAGTAATCTATCTAGTAGAATAAATCTAATTGCATATTCTTGGCTGTTAATAGAGGTAAGCTCTCTGAAGGTATAGATCTAAAAGACAATTTATGTAGAGCAGTAATTCTTTTTGGTGTCCCTTATGCAAATCTTTCAGACCCTTATATAATATGTAAAAAAACCCATGCTTAGCTTTATTTGGGAGAAAGTCAATGGTATTAGAAAGATGCAGTTAAAGTAGTCAATTAATCTGCAGGAAGATGCATACGTTACAAAGATGATTGGGGTTGTATTTTCTTCTTAGATTCTTAATACAGTCTAGAAACAAATATAAATTAACATATTTCTAAATGGATTTTAGAGGGTTAAAGAAAAATTTATAAAGATTCAGAAGATGAATGGATTGAAGCCTATGATAATTTTTTAGATATGAAGGCTTTAGAGAAAACAGACTAAGATTAAAGTTGA