TTHERM_00599960

Length: 2487 bp

cDNA Sequence

ATGAGTAAGAGGCCAGGAGAAGAAATTTAAGGGAATGATCCTTAAAAAAAAATAAAAACTGCAGATCTTCCTACAGCTCCAAGTACAGCAAATAAAATATCTTATGGCAGTCTTAAACCTCCAACATCTAGCAGTTCTTCTATATCTTATGCTGCTTTTAAAAAATAATAATTATCTACTATGAAATAGCCTGCTAAACCAATTAGCCAATAATAGGTTCCTTAATCTACAGGATCTAGTTTGACATCTGCTGCAGCAGCTGTATAAAATAATTAAAATGCTTCAAAATAATTAACATAATAGGGTAGTTCATAAGCTTAAGATAGTAAAATAATTGATGCCGCATCTTCAAATTAAAAAAATCAAGATTCTAATGCATCAAATAAAAATGAAAATAAAAACACTTCTGAACAATCTTAAAATAAATTTAGTGAAGCTTAACCTAACCCATAATAAGTAGCACCTAAAACAATTGATTTAAAAAGCTAGTAATAATAAATCATAGAAAGAGCTAAGAAGTTAAGAGAAGAAGAAAAAAGACTTGCTGAATTAAAAAAGAATACAGCTGTCATTTAAAAAGTCTAAAATGCTTAATAAGGAATAAAACCTGGCTAACCAAGTTCTATAAGTCAAACAAAAATTCAAAAAGAATTAAAGAAGAAAGAGGAAAAGAAACCTCTTACAAAATAAGAATTAGAAATGAAATAACTTTAGGAATTTGCTAAGAAAAAGGAAAAAGAATAAAAATTAATTGAAAAATTGCTGAAAGAAGGCAAAATAAAGCCAGAAGATTTAGATAAATCAAGCAAGAAGGAAGAGATAAAAATTGACAGCAAAGAAAAAGAAGTACGTTTAGATGAAAAAGGTAATTTAATCGATATTAAGGGTAACATAATTGTAATTGACTCAAATAAAAGCACCTTAAAAATCAATTAACAAAAGAAGCAACTAGATAAATTAACTAAAATGGCTAGAAATGCTCGTTTTTAAAACTCACAAGTATTTTAAGATTCTAGCATATTTACTACAACAAGTTTAAAGAGAGAAAGGAAGAAAATGCATGCACTTAACTTTATAGAAGATACAAATTAAATTGAAGACGAAAAAGAAGAATATGAAGATAAAATGGATATTGAGAGTAAGAGTGAAGAAGATTAATCTGGTTCTAGTTCAAGTGAAAGTGAGACTGAACAAAAAATGGAATAAGAAAACCAATAAAATGAAGAAAATATAGAAAAAAATGAAGATTTCAGATAATTGATTCAAAAAACTGAAACTGATTACAGAAGAGAAGATTTTTAGAAAACAAATAGCAAATATTTACAAAGTTTACACAAAAAAAAGTAGAGTTTGAAGCAAAAGCATCACGATCCTATTCCAGATATTGAATGGTGGGATTTGGCATTATTCGATAATACTAGAAGATACTACTTACCATTAGACCAAGCTAACTAAACAATTGCTAATTAAGCAATTCAAGCAGGAAACGAATCTAATGCTACAACTAATAACAATCCTGAAAATTAAACAGCCAACGAAAATAATTTGTCAATTAACATTTTGGATAATTTAGAGATTATTAAGCAATTATTGTCTAAATTATAAGTTGAAAATTTCGAATACTCTAAGGATTATTATCGTTAAGAAAAAATTACTAACTTGATAGAGCATCCTAAGCCTTTTAAAAATGATGGATTGCCTAATTCTAATCAACTCGTAGTCATTCCTAACTACTTAACTAAGAAAGAGTAAAAAAAGCTGAGCAGACGTCATCGTTTAGAAAAAGAAAAAGAAAAGCAAGATAAAATAAAATTAGGATTAATCAAGCCTCCTCCTCCTAAAGTTAGACTAAAAAATATGATGCGTGTTTTAGGTAATGAAGCAGTTGCTGATCCTACAAAAATGGAAGCTTTGGTTAGATAAGGCATAGCTGAGCGTTTGTAGGAGCATCTTCGTAGAAATTAAGAACGTTAATTGACTAAAGAGCAAAAAGCTGAGAAATTCTTACGTAAGCTTAAAAGAGATAGTGCTATTGAATGTAGAGTAGCCCTATTCAGAATTGAAAATCTATAAGACAGAGTTCATAAGTTTAAGGTTGACATCAATGCATAATAAATGTAATTGCATGGTGCTCTTATTAACCCAGTAGAAAATCCTGAAAGTAGATCTACTATAAATATGCCTGCAATAGTCCTCGTTGAAGGTGGTCCCAAGGCAATTAAGTTTTATAAAAAGCTTATGCTTCGTCGTATTAAATGGAACAAAAACAGCTACTTACCTAAAGATGAAAATGGTGAAATTATTACTCCAGTTGACTTGACAGATAATAAATGTGCTTTAGTTTGGGAAGGAGTAGTTAAAGATCACAATTTCAATAAATGGAAAGTTCATGATGTGGACAGTGAAGTAGAAGCTAGAAGAGTTTTTACAGAAAAAAATGTAGAGTTTTACTTTGACATGGCAATTAACTATTAATATCCTAATTGA