TTHERM_00600110

Length: 1722 bp

cDNA Sequence

ATGGCTGCCCAAAAGGATTTAAAGAAGGATAAAAAAGACATTAAGCTTCAAAATATCGAATTTGTTGGTATAGTTAGAGAAGTTCACTCTGGTGATTCTCTCACAATCTAATCAACTAAAACTAATAACATCGCCAGATTTTTCTTGACTCACGTCAGAGCTCCTAAGGTTGGAACCAATGATACACAAGATAAACCTTATGCTTTTGAATCTAAAGAATTCCTTCGTAAGAAACTCATAGGTCAATAAGTAGAAGTAAAATTTGAATATGAAAAAACTGTTAAAGTCGCCAAATCTTGGGAAGATGACAGTGAAGCTACTGAAAAACAAATGAACTTCTGTACTGTGTTCTACTAAGGCTAAAATATTAATCTCTAATTAATCCAAGAAGGTTATGCTGAGTTCAATTTCGCCAGAACAGAAGAAGAAAAATCATAATATCACGATGAATTGAAGACTGCTTCTGAAGAAGCTGCTAAGAAAAAGAAGGGTCTCCACTCTACCAAAAATATCCCTCTCCACAGATTCAATGATATTTCTCGTTTGAAAAATAAGCCTAAACTTCTTGAGCACTTCAACTCATTGAAATCAAAAGCTAGATTAACTGGTGTTGTTGAATTGGTCATTAGTGGTGGTATTTATAAAGTTAGAGTTAATGAAGAACCATACTCCATTCTTGTTCTTTTAAGCGGTGTCAGATGCTTACCTCCTGATAGTAATATTCCCGAATACACCACCTGGTCAAGCAAAGCATTAGATTTTGCTAAAAATAATCTACTTTAGAGAGATGTTGAAATCCAATTAGAACGTATGGATAACAAGGGTAAGTTCCATGCTACTGTTTTAGTGAATAAGTAAAATTATGCAAGCTAGCTCTTATCTTAAGGACTTTGCTTTACTTTTGGTAAGGCTAAACATACTACCGAATATGAAGCTATTGAAAAGGAAGTATAAGCAGCCAAGAAAGGATTATTCGGTTCAAATAAAATAAATATTGAAAGTTTACGTGGTTAAAATTTTGATGTAGATTAAAAAAATGTTAAAGCTATTTCAGGTAGCATTTAAGCCAAGTTAAGCGAATTAATTAACACTGATGAATTCTATATCCAAGAAAATTCTCGTATTGCTGTTTTAGATAAGATGGAAAAGGAACTCGATGATTTTGACTTAGAAGCTTATCCTAAACTTTAATAACCTGTTTAGCCTGGTACACCTTGTGTAGCTCTTTTCAGTGGAGACAATAATTATTATAGAGGTAAAATAGTTAAGAAGCGTAATGATAATAAATACGAAGTATTTTTCATTGATTACGGCTTCTACGATAGTGTTCATATTGATGATATGTGCAAATTACCTGAAAAATGGGCTCCTATTCAACCATTTGCTATCAAGCTCGGATTAGCTTACTGCGTTGGTTTACACGATAAGCATCCCTTGGCAGTAGAAAGTGATGAAACATTCAAAGAGTTAGCTTGGGGCAAAAAAATCCACTTATCTTACAAATACGAAGACAACGGCGTAAAATATGTTATTGTATAAGATGCAGCTAATACTCCCTTGAACTAAACCATCAACTTCCAACTTCTTAAAAAGGGTTTGGTTAGATTAGATGAAGGAGTAGCCCTCCCTGAAGAACTTCAAGCTTGGTAAGAAGAATAAGATTTCGCTAAAGAAAAGAAAATCGGTCTTTGGGCTTATGATGAATAAGAAAATGATGATTGA