TTHERM_00600300

Length: 816 bp

cDNA Sequence

ATGAGTAACAATTAAGAAATTTTCGAAAAACAAGTTTAAAGTCAAGATTTATAAGAATAAGAATGTAAAAAGAAACCTAAGAAGTTTTTCGACATTGACAGTTTGCTTAGCAAGCTCATAAAGCGTTTAATTCCTTAACAGCTAAACTAAAAAACATAGTTTTGTAAGCATGACTGTGGGTGTAGTGAAGAAATTATAAAGTAAACCCTCAAGTCTTTTTTGCTTGGTTATAGCGTTATAGGAGCAGTTGATATAATCGCATTAGTTTTAAAATCTAAAATGTTAAAAAAGAACCCATTTATTTTGTTTGTAACCTTGGTCTCTAGTAAAAATATTCGCTTTGCCTCCTTCCCAGCTTTATATACTCTTGTGATGAAATCACTTATGTGTGTATTGAGAAGAATTTTTAAGGAAGATAATGGCAAAATATGGTTTATCAGTGGCTTTGTAGGAGGATTCTTGAGTTTACTGACAAAAGAAAAAAATAATCGTTCAATGTGGAGTCTTTTCCTTTTAACTAGAGCGTTTGAAACATTTTATAGATATCACATAATTTAAAAGACTATTCCTAAATTTTAGCTAGATTATGTACTAGTGTATTGCTTGATGATTGGCTTCACAGTAAGTGTTTACTTTACTGAACCCTCTTGCAATTCAAGAGGTCTTCATAAGGCATGGGAAAACTTTTCATGCGAGCACAGTGGAGACTATGGAATTCGTAAAATTTATATGGGTATAATGAATAAAAAATTGCAAATTGATGGTTTACCTACTGATGAGCCAGATAAATTTATAAACTGGAATAGAAAATTTTGA